Mutagenetix > Incidental Mutation

Incidental Mutation 'R9353:Cntln'

708208

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R9353 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to T at 84884360 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

probably benign
Transcript: ENSMUST00000047023

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102819

SMART Domains

Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
coiled coil region	166	277	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169371

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (44/45)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp7b	A	T	8: 22,027,874	V316D	possibly damaging	Het
Cc2d2a	T	C	5: 43,703,349		probably null	Het
Ccdc88a	A	G	11: 29,477,433	D1046G	probably damaging	Het
Ccl12	A	T	11: 82,102,611	D25V	possibly damaging	Het
Cdh23	G	A	10: 60,307,527	A3005V	possibly damaging	Het
Ces3a	G	T	8: 105,049,915	R45L	probably benign	Het
Crybg3	C	A	16: 59,600,744		probably null	Het
Cxxc4	G	T	3: 134,240,152	G165C	unknown	Het
Dab2ip	G	A	2: 35,708,839	C181Y	probably damaging	Het
Dnah11	A	G	12: 118,179,699	V403A	probably benign	Het
Dnah12	T	C	14: 26,856,550	S3089P	probably damaging	Het
Dnajc13	A	T	9: 104,190,372	I1196N	probably benign	Het
Faiml	T	C	9: 99,234,409	Y76C	probably damaging	Het
Fam171b	T	A	2: 83,876,684	H299Q	probably benign	Het
Fbxo36	A	G	1: 84,896,538	N85S	probably benign	Het
Filip1	A	G	9: 79,818,341	F999L	possibly damaging	Het
Gm5096	A	G	18: 87,756,830	E159G	probably damaging	Het
Gm9573	T	C	17: 35,619,653	T1214A	unknown	Het
Gtf3c3	A	T	1: 54,406,052	S614R	possibly damaging	Het
Il18rap	A	G	1: 40,547,928	T457A	probably benign	Het
Inmt	C	T	6: 55,174,999		probably benign	Het
Kcnb1	C	T	2: 167,105,087	G614S	probably benign	Het
Kdm2a	C	T	19: 4,343,113	D405N		Het
Kdm5a	T	A	6: 120,427,769	V1324E	probably benign	Het
Lyn	A	T	4: 3,746,804	Y194F	possibly damaging	Het
Mdn1	A	G	4: 32,693,504	D1043G	probably damaging	Het
Mier1	T	A	4: 103,155,603	H397Q	probably damaging	Het
Mov10l1	T	A	15: 88,988,419	D105E	possibly damaging	Het
Nav3	A	G	10: 109,718,204	S1766P	probably damaging	Het
Ncdn	T	A	4: 126,750,671	E119D	probably benign	Het
Nckipsd	C	A	9: 108,814,272	A416E	probably damaging	Het
Nek5	A	G	8: 22,073,945	V623A	probably benign	Het
Oas1g	A	G	5: 120,885,923	Y108H	possibly damaging	Het
Olfr702	T	C	7: 106,823,855	T224A	probably benign	Het
P2ry1	T	C	3: 61,004,495	S352P	probably damaging	Het
Pde6a	T	C	18: 61,257,311	F535S	probably damaging	Het
Pitpnb	T	C	5: 111,383,025	L228P	probably damaging	Het
Rbck1	G	T	2: 152,319,225	H368N	probably damaging	Het
Snrnp35	T	A	5: 124,490,496	V124E	probably damaging	Het
Spdye4a	C	T	5: 143,219,038	M224I	probably benign	Het
Stau1	A	G	2: 166,950,347	Y424H	probably damaging	Het
Sult1c1	A	T	17: 53,964,032	D190E	probably benign	Het
Thbs1	A	G	2: 118,122,570	D887G	probably damaging	Het
Tiam2	C	T	17: 3,507,799	Q1233*	probably null	Het
Tmem88	A	G	11: 69,398,113	V38A	probably damaging	Het
Vmn1r219	G	A	13: 23,162,732	M30I	probably benign	Het
Zswim3	A	G	2: 164,820,341	H247R	probably damaging	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGGATGTAAAGTAGGCCCTC -3'
(R):5'- CCAAAGTAAGTCGCTTTTATCCGC -3'

Sequencing Primer
(F):5'- CGGAGCTAGGGCGTTAGG -3'
(R):5'- GCTTTTATCCGCGACGACC -3'

Posted On

2022-04-18