Incidental Mutation 'R9353:Cntln'
ID 708208
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms B430108F07Rik, D530005L17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R9353 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84884309-85131921 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 84884360 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably benign
Transcript: ENSMUST00000047023
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102819
SMART Domains Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
coiled coil region 166 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,027,874 V316D possibly damaging Het
Cc2d2a T C 5: 43,703,349 probably null Het
Ccdc88a A G 11: 29,477,433 D1046G probably damaging Het
Ccl12 A T 11: 82,102,611 D25V possibly damaging Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Ces3a G T 8: 105,049,915 R45L probably benign Het
Crybg3 C A 16: 59,600,744 probably null Het
Cxxc4 G T 3: 134,240,152 G165C unknown Het
Dab2ip G A 2: 35,708,839 C181Y probably damaging Het
Dnah11 A G 12: 118,179,699 V403A probably benign Het
Dnah12 T C 14: 26,856,550 S3089P probably damaging Het
Dnajc13 A T 9: 104,190,372 I1196N probably benign Het
Faiml T C 9: 99,234,409 Y76C probably damaging Het
Fam171b T A 2: 83,876,684 H299Q probably benign Het
Fbxo36 A G 1: 84,896,538 N85S probably benign Het
Filip1 A G 9: 79,818,341 F999L possibly damaging Het
Gm5096 A G 18: 87,756,830 E159G probably damaging Het
Gm9573 T C 17: 35,619,653 T1214A unknown Het
Gtf3c3 A T 1: 54,406,052 S614R possibly damaging Het
Il18rap A G 1: 40,547,928 T457A probably benign Het
Inmt C T 6: 55,174,999 probably benign Het
Kcnb1 C T 2: 167,105,087 G614S probably benign Het
Kdm2a C T 19: 4,343,113 D405N Het
Kdm5a T A 6: 120,427,769 V1324E probably benign Het
Lyn A T 4: 3,746,804 Y194F possibly damaging Het
Mdn1 A G 4: 32,693,504 D1043G probably damaging Het
Mier1 T A 4: 103,155,603 H397Q probably damaging Het
Mov10l1 T A 15: 88,988,419 D105E possibly damaging Het
Nav3 A G 10: 109,718,204 S1766P probably damaging Het
Ncdn T A 4: 126,750,671 E119D probably benign Het
Nckipsd C A 9: 108,814,272 A416E probably damaging Het
Nek5 A G 8: 22,073,945 V623A probably benign Het
Oas1g A G 5: 120,885,923 Y108H possibly damaging Het
Olfr702 T C 7: 106,823,855 T224A probably benign Het
P2ry1 T C 3: 61,004,495 S352P probably damaging Het
Pde6a T C 18: 61,257,311 F535S probably damaging Het
Pitpnb T C 5: 111,383,025 L228P probably damaging Het
Rbck1 G T 2: 152,319,225 H368N probably damaging Het
Snrnp35 T A 5: 124,490,496 V124E probably damaging Het
Spdye4a C T 5: 143,219,038 M224I probably benign Het
Stau1 A G 2: 166,950,347 Y424H probably damaging Het
Sult1c1 A T 17: 53,964,032 D190E probably benign Het
Thbs1 A G 2: 118,122,570 D887G probably damaging Het
Tiam2 C T 17: 3,507,799 Q1233* probably null Het
Tmem88 A G 11: 69,398,113 V38A probably damaging Het
Vmn1r219 G A 13: 23,162,732 M30I probably benign Het
Zswim3 A G 2: 164,820,341 H247R probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
R7670:Cntln UTSW 4 84979340 missense possibly damaging 0.66
R7707:Cntln UTSW 4 84884616 missense probably damaging 1.00
R7895:Cntln UTSW 4 85063324 missense possibly damaging 0.91
R8176:Cntln UTSW 4 84888689 missense probably damaging 0.99
R8247:Cntln UTSW 4 85100780 missense probably benign 0.39
R8264:Cntln UTSW 4 85098411 missense probably damaging 1.00
R8293:Cntln UTSW 4 85033838 missense probably damaging 1.00
R8536:Cntln UTSW 4 84957049 missense probably damaging 1.00
R8844:Cntln UTSW 4 84973997 missense probably damaging 1.00
R8924:Cntln UTSW 4 84888699 missense probably damaging 1.00
R8955:Cntln UTSW 4 85067873 missense possibly damaging 0.85
R8960:Cntln UTSW 4 85100724 missense possibly damaging 0.59
R8979:Cntln UTSW 4 85130673 missense probably damaging 1.00
R9255:Cntln UTSW 4 85100866 missense possibly damaging 0.93
R9314:Cntln UTSW 4 85006482 missense probably damaging 1.00
R9361:Cntln UTSW 4 85049914 missense probably benign 0.23
R9376:Cntln UTSW 4 84957021 missense probably benign 0.24
R9382:Cntln UTSW 4 85050081 missense probably benign 0.13
R9471:Cntln UTSW 4 85049782 missense possibly damaging 0.62
R9478:Cntln UTSW 4 84979393 missense probably benign 0.00
R9527:Cntln UTSW 4 84973883 missense probably damaging 1.00
R9788:Cntln UTSW 4 85049856 missense probably damaging 1.00
R9793:Cntln UTSW 4 85067561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGATGTAAAGTAGGCCCTC -3'
(R):5'- CCAAAGTAAGTCGCTTTTATCCGC -3'

Sequencing Primer
(F):5'- CGGAGCTAGGGCGTTAGG -3'
(R):5'- GCTTTTATCCGCGACGACC -3'
Posted On 2022-04-18