Incidental Mutation 'R9353:Cntln'
ID 708208
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R9353 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 84802597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably benign
Transcript: ENSMUST00000047023
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102819
SMART Domains Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
coiled coil region 166 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,517,890 (GRCm39) V316D possibly damaging Het
Bhmt1b A G 18: 87,774,954 (GRCm39) E159G probably damaging Het
Cc2d2a T C 5: 43,860,691 (GRCm39) probably null Het
Ccdc88a A G 11: 29,427,433 (GRCm39) D1046G probably damaging Het
Ccl12 A T 11: 81,993,437 (GRCm39) D25V possibly damaging Het
Cdh23 G A 10: 60,143,306 (GRCm39) A3005V possibly damaging Het
Ces3a G T 8: 105,776,547 (GRCm39) R45L probably benign Het
Crybg3 C A 16: 59,421,107 (GRCm39) probably null Het
Cxxc4 G T 3: 133,945,913 (GRCm39) G165C unknown Het
Dab2ip G A 2: 35,598,851 (GRCm39) C181Y probably damaging Het
Dnah11 A G 12: 118,143,434 (GRCm39) V403A probably benign Het
Dnah12 T C 14: 26,578,507 (GRCm39) S3089P probably damaging Het
Dnajc13 A T 9: 104,067,571 (GRCm39) I1196N probably benign Het
Faiml T C 9: 99,116,462 (GRCm39) Y76C probably damaging Het
Fam171b T A 2: 83,707,028 (GRCm39) H299Q probably benign Het
Fbxo36 A G 1: 84,874,259 (GRCm39) N85S probably benign Het
Filip1 A G 9: 79,725,623 (GRCm39) F999L possibly damaging Het
Gtf3c3 A T 1: 54,445,211 (GRCm39) S614R possibly damaging Het
Il18rap A G 1: 40,587,088 (GRCm39) T457A probably benign Het
Inmt C T 6: 55,151,984 (GRCm39) probably benign Het
Kcnb1 C T 2: 166,947,007 (GRCm39) G614S probably benign Het
Kdm2a C T 19: 4,393,141 (GRCm39) D405N Het
Kdm5a T A 6: 120,404,730 (GRCm39) V1324E probably benign Het
Lyn A T 4: 3,746,804 (GRCm39) Y194F possibly damaging Het
Mdn1 A G 4: 32,693,504 (GRCm39) D1043G probably damaging Het
Mier1 T A 4: 103,012,800 (GRCm39) H397Q probably damaging Het
Mov10l1 T A 15: 88,872,622 (GRCm39) D105E possibly damaging Het
Muc21 T C 17: 35,930,545 (GRCm39) T1214A unknown Het
Nav3 A G 10: 109,554,065 (GRCm39) S1766P probably damaging Het
Ncdn T A 4: 126,644,464 (GRCm39) E119D probably benign Het
Nckipsd C A 9: 108,691,471 (GRCm39) A416E probably damaging Het
Nek5 A G 8: 22,563,961 (GRCm39) V623A probably benign Het
Oas1g A G 5: 121,023,986 (GRCm39) Y108H possibly damaging Het
Or13n4 T C 7: 106,423,062 (GRCm39) T224A probably benign Het
P2ry1 T C 3: 60,911,916 (GRCm39) S352P probably damaging Het
Pde6a T C 18: 61,390,382 (GRCm39) F535S probably damaging Het
Pitpnb T C 5: 111,530,891 (GRCm39) L228P probably damaging Het
Rbck1 G T 2: 152,161,145 (GRCm39) H368N probably damaging Het
Snrnp35 T A 5: 124,628,559 (GRCm39) V124E probably damaging Het
Spdye4a C T 5: 143,204,793 (GRCm39) M224I probably benign Het
Stau1 A G 2: 166,792,267 (GRCm39) Y424H probably damaging Het
Sult1c2 A T 17: 54,271,060 (GRCm39) D190E probably benign Het
Thbs1 A G 2: 117,953,051 (GRCm39) D887G probably damaging Het
Tiam2 C T 17: 3,558,074 (GRCm39) Q1233* probably null Het
Tmem88 A G 11: 69,288,939 (GRCm39) V38A probably damaging Het
Vmn1r219 G A 13: 23,346,902 (GRCm39) M30I probably benign Het
Zswim3 A G 2: 164,662,261 (GRCm39) H247R probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGATGTAAAGTAGGCCCTC -3'
(R):5'- CCAAAGTAAGTCGCTTTTATCCGC -3'

Sequencing Primer
(F):5'- CGGAGCTAGGGCGTTAGG -3'
(R):5'- GCTTTTATCCGCGACGACC -3'
Posted On 2022-04-18