Mutagenetix > Incidental Mutation

Incidental Mutation 'R9353:Dnajc13'

708224

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R9353 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104190372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1196 (I1196N)

Ref Sequence

ENSEMBL: ENSMUSP00000139804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

AlphaFold

D4AFX7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035170
AA Change: I1191N

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: I1191N

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185503

Predicted Effect

probably benign
Transcript: ENSMUST00000186788
AA Change: I1196N

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: I1196N

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp7b	A	T	8: 22,027,874	V316D	possibly damaging	Het
Cc2d2a	T	C	5: 43,703,349		probably null	Het
Ccdc88a	A	G	11: 29,477,433	D1046G	probably damaging	Het
Ccl12	A	T	11: 82,102,611	D25V	possibly damaging	Het
Cdh23	G	A	10: 60,307,527	A3005V	possibly damaging	Het
Ces3a	G	T	8: 105,049,915	R45L	probably benign	Het
Cntln	G	T	4: 84,884,360		probably benign	Het
Crybg3	C	A	16: 59,600,744		probably null	Het
Cxxc4	G	T	3: 134,240,152	G165C	unknown	Het
Dab2ip	G	A	2: 35,708,839	C181Y	probably damaging	Het
Dnah11	A	G	12: 118,179,699	V403A	probably benign	Het
Dnah12	T	C	14: 26,856,550	S3089P	probably damaging	Het
Faiml	T	C	9: 99,234,409	Y76C	probably damaging	Het
Fam171b	T	A	2: 83,876,684	H299Q	probably benign	Het
Fbxo36	A	G	1: 84,896,538	N85S	probably benign	Het
Filip1	A	G	9: 79,818,341	F999L	possibly damaging	Het
Gm5096	A	G	18: 87,756,830	E159G	probably damaging	Het
Gm9573	T	C	17: 35,619,653	T1214A	unknown	Het
Gtf3c3	A	T	1: 54,406,052	S614R	possibly damaging	Het
Il18rap	A	G	1: 40,547,928	T457A	probably benign	Het
Inmt	C	T	6: 55,174,999		probably benign	Het
Kcnb1	C	T	2: 167,105,087	G614S	probably benign	Het
Kdm2a	C	T	19: 4,343,113	D405N		Het
Kdm5a	T	A	6: 120,427,769	V1324E	probably benign	Het
Lyn	A	T	4: 3,746,804	Y194F	possibly damaging	Het
Mdn1	A	G	4: 32,693,504	D1043G	probably damaging	Het
Mier1	T	A	4: 103,155,603	H397Q	probably damaging	Het
Mov10l1	T	A	15: 88,988,419	D105E	possibly damaging	Het
Nav3	A	G	10: 109,718,204	S1766P	probably damaging	Het
Ncdn	T	A	4: 126,750,671	E119D	probably benign	Het
Nckipsd	C	A	9: 108,814,272	A416E	probably damaging	Het
Nek5	A	G	8: 22,073,945	V623A	probably benign	Het
Oas1g	A	G	5: 120,885,923	Y108H	possibly damaging	Het
Olfr702	T	C	7: 106,823,855	T224A	probably benign	Het
P2ry1	T	C	3: 61,004,495	S352P	probably damaging	Het
Pde6a	T	C	18: 61,257,311	F535S	probably damaging	Het
Pitpnb	T	C	5: 111,383,025	L228P	probably damaging	Het
Rbck1	G	T	2: 152,319,225	H368N	probably damaging	Het
Snrnp35	T	A	5: 124,490,496	V124E	probably damaging	Het
Spdye4a	C	T	5: 143,219,038	M224I	probably benign	Het
Stau1	A	G	2: 166,950,347	Y424H	probably damaging	Het
Sult1c1	A	T	17: 53,964,032	D190E	probably benign	Het
Thbs1	A	G	2: 118,122,570	D887G	probably damaging	Het
Tiam2	C	T	17: 3,507,799	Q1233*	probably null	Het
Tmem88	A	G	11: 69,398,113	V38A	probably damaging	Het
Vmn1r219	G	A	13: 23,162,732	M30I	probably benign	Het
Zswim3	A	G	2: 164,820,341	H247R	probably damaging	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
impressario	UTSW	9	104213886	missense	probably benign	0.12
Kaiser	UTSW	9	104214188	missense	probably damaging	1.00
BB008:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
BB018:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
R7856:Dnajc13	UTSW	9	104167485	missense	possibly damaging	0.83
R7931:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
R7995:Dnajc13	UTSW	9	104174363	missense	probably damaging	1.00
R8319:Dnajc13	UTSW	9	104190391	missense	probably benign	0.00
R8354:Dnajc13	UTSW	9	104217728	missense	probably damaging	1.00
R8680:Dnajc13	UTSW	9	104180139	missense	probably benign
R8686:Dnajc13	UTSW	9	104170805	missense	probably benign	0.00
R8707:Dnajc13	UTSW	9	104192648	missense	probably damaging	0.96
R8847:Dnajc13	UTSW	9	104180161	nonsense	probably null
R8868:Dnajc13	UTSW	9	104165788	missense	probably benign	0.13
R8986:Dnajc13	UTSW	9	104180131	missense	probably damaging	1.00
R9139:Dnajc13	UTSW	9	104207840	missense	probably benign	0.02
R9334:Dnajc13	UTSW	9	104174460	missense	probably benign	0.00
R9470:Dnajc13	UTSW	9	104230720	missense	probably benign	0.01
R9528:Dnajc13	UTSW	9	104237705	missense	probably benign
R9578:Dnajc13	UTSW	9	104238527	missense	probably benign	0.04
R9658:Dnajc13	UTSW	9	104238529	missense	probably benign	0.11
R9691:Dnajc13	UTSW	9	104165012	missense	probably damaging	1.00
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTCAGGCCTTGTCAAAGC -3'
(R):5'- TCCCTAGAGCACAGAAGTGG -3'

Sequencing Primer
(F):5'- CAGGCCTTGTCAAAGCCTATTAG -3'
(R):5'- GCTACCTGGCCTTGAACTCATAGAG -3'

Posted On

2022-04-18