Mutagenetix > Incidental Mutation

Incidental Mutation 'R9354:Itga8'

708245

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R9354 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12232857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 351 (S351G)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028106
AA Change: S351G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: S351G

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172791
AA Change: S351G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: S351G

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	G	6: 40,928,539	V61A	probably damaging	Het
4933409G03Rik	A	G	2: 68,606,529	Q181R	unknown	Het
Acsl1	T	G	8: 46,513,716	C242G	probably benign	Het
Agap2	A	C	10: 127,087,235	N646T	unknown	Het
Ankrd44	A	T	1: 54,648,279	*994R	probably null	Het
Apol7c	C	T	15: 77,525,912	R278H	possibly damaging	Het
Birc6	A	G	17: 74,614,406	E2166G	probably benign	Het
Caskin2	G	A	11: 115,802,642	T528M	probably damaging	Het
Ccdc30	G	T	4: 119,373,653	P15Q	possibly damaging	Het
Cenpf	G	A	1: 189,646,917	T45I		Het
Cep68	T	C	11: 20,238,569	E612G	probably damaging	Het
Chpf2	T	C	5: 24,591,394	L446P	probably damaging	Het
Ctsl	A	T	13: 64,369,036	Y40N	probably damaging	Het
Dis3l	T	C	9: 64,314,640	N496S	probably benign	Het
Espnl	A	T	1: 91,344,601	D561V	probably benign	Het
Flnb	T	A	14: 7,818,411	L87Q	probably benign	Het
Gbp9	T	A	5: 105,084,959	I276F	possibly damaging	Het
Gid4	G	T	11: 60,417,792	R46L	probably benign	Het
Gper1	G	A	5: 139,426,274	D125N	possibly damaging	Het
Gpr146	A	G	5: 139,392,611	N56S	probably benign	Het
Grhpr	G	T	4: 44,981,465	R5L	probably benign	Het
Gstm6	A	T	3: 107,942,702	N59K	probably damaging	Het
Hdac7	A	T	15: 97,796,888	F802L	probably damaging	Het
Igfbpl1	A	T	4: 45,816,348	V159D	probably damaging	Het
Itgad	C	A	7: 128,185,974	H354Q	probably damaging	Het
Jmjd1c	T	C	10: 67,224,096	S641P	probably damaging	Het
Klhl33	T	C	14: 50,892,928	T110A	probably benign	Het
Lcorl	T	A	5: 45,733,626	K545*	probably null	Het
Lilra6	A	G	7: 3,911,629	S546P	probably damaging	Het
Ly6c1	T	A	15: 75,044,622	I124F	probably benign	Het
Map4	A	G	9: 110,068,779	T858A	probably benign	Het
March5	G	T	19: 37,207,865		probably benign	Het
Muc2	A	G	7: 141,753,420	K769E		Het
Myh6	T	A	14: 54,963,535	I157F	probably damaging	Het
Naip1	A	G	13: 100,427,486	V389A	probably benign	Het
Olfr549	G	A	7: 102,555,190	R302H	possibly damaging	Het
Pcdhgc4	A	G	18: 37,816,587	H352R	probably benign	Het
Pde8a	C	T	7: 81,332,871	T746I	probably damaging	Het
Pick1	T	C	15: 79,239,648	V73A	probably damaging	Het
Ppwd1	C	T	13: 104,205,572	V625I	probably benign	Het
Prune2	A	G	19: 17,122,622	E1830G	probably benign	Het
Ralgapb	A	G	2: 158,437,393	N445S	possibly damaging	Het
Rapgef6	G	T	11: 54,619,923	R222L	possibly damaging	Het
Rorc	A	T	3: 94,372,863		probably benign	Het
Rps6ka1	A	C	4: 133,867,121		probably null	Het
Sdk2	T	C	11: 113,834,931	Y1164C	probably benign	Het
Sema5a	T	A	15: 32,562,756	Y304*	probably null	Het
Slc26a4	A	T	12: 31,535,256	V513D	possibly damaging	Het
Slf2	T	A	19: 44,948,032	D705E	probably damaging	Het
Spag17	A	G	3: 100,027,589	T704A	probably benign	Het
Tex15	C	G	8: 33,573,316	Q925E	possibly damaging	Het
Tmem2	A	G	19: 21,802,025	S400G	probably benign	Het
Trim38	A	T	13: 23,785,892	T145S	probably benign	Het
Trpm3	G	A	19: 22,448,332	C17Y	probably benign	Het
Usp42	A	G	5: 143,715,272	Y999H	probably benign	Het
Vat1	A	C	11: 101,460,615	M300R	probably benign	Het
Vmn1r85	T	A	7: 13,084,798	I140F	probably damaging	Het
Vmn2r57	T	C	7: 41,400,239	I695M	probably benign	Het
Wnk1	C	T	6: 119,965,699	R789Q	unknown	Het
Zswim5	G	A	4: 116,987,035	G1090D	probably damaging	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AATGGCCATAGCTTCCTTCTTG -3'
(R):5'- CAGATGATTGTAAAATGACCCTCAGG -3'

Sequencing Primer
(F):5'- CTTGCAATAGTAACATAGCCCTGAGG -3'
(R):5'- TTGTAAAATGACCCTCAGGAAAGG -3'

Posted On

2022-04-18