Incidental Mutation 'R9354:Igfbpl1'
ID 708252
Institutional Source Beutler Lab
Gene Symbol Igfbpl1
Ensembl Gene ENSMUSG00000035551
Gene Name insulin-like growth factor binding protein-like 1
Synonyms 2810011G06Rik, 2810453O06Rik, IGFBP-like protein
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9354 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 45809507-45826827 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45816348 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 159 (V159D)
Ref Sequence ENSEMBL: ENSMUSP00000036974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044297]
AlphaFold Q80W15
Predicted Effect probably damaging
Transcript: ENSMUST00000044297
AA Change: V159D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036974
Gene: ENSMUSG00000035551
AA Change: V159D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IB 28 100 1.31e-3 SMART
KAZAL 82 143 6.59e-14 SMART
IGc2 159 242 5.04e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,436,873 (GRCm39) Q181R unknown Het
Acsl1 T G 8: 46,966,753 (GRCm39) C242G probably benign Het
Agap2 A C 10: 126,923,104 (GRCm39) N646T unknown Het
Ankrd44 A T 1: 54,687,438 (GRCm39) *994R probably null Het
Apol7c C T 15: 77,410,112 (GRCm39) R278H possibly damaging Het
Birc6 A G 17: 74,921,401 (GRCm39) E2166G probably benign Het
Caskin2 G A 11: 115,693,468 (GRCm39) T528M probably damaging Het
Ccdc30 G T 4: 119,230,850 (GRCm39) P15Q possibly damaging Het
Cemip2 A G 19: 21,779,389 (GRCm39) S400G probably benign Het
Cenpf G A 1: 189,379,114 (GRCm39) T45I Het
Cep68 T C 11: 20,188,569 (GRCm39) E612G probably damaging Het
Chpf2 T C 5: 24,796,392 (GRCm39) L446P probably damaging Het
Ctsl A T 13: 64,516,850 (GRCm39) Y40N probably damaging Het
Dis3l T C 9: 64,221,922 (GRCm39) N496S probably benign Het
Espnl A T 1: 91,272,323 (GRCm39) D561V probably benign Het
Flnb T A 14: 7,818,411 (GRCm38) L87Q probably benign Het
Gbp9 T A 5: 105,232,825 (GRCm39) I276F possibly damaging Het
Gid4 G T 11: 60,308,618 (GRCm39) R46L probably benign Het
Gper1 G A 5: 139,412,029 (GRCm39) D125N possibly damaging Het
Gpr146 A G 5: 139,378,366 (GRCm39) N56S probably benign Het
Grhpr G T 4: 44,981,465 (GRCm39) R5L probably benign Het
Gstm6 A T 3: 107,850,018 (GRCm39) N59K probably damaging Het
Hdac7 A T 15: 97,694,769 (GRCm39) F802L probably damaging Het
Itga8 T C 2: 12,237,668 (GRCm39) S351G possibly damaging Het
Itgad C A 7: 127,785,146 (GRCm39) H354Q probably damaging Het
Jmjd1c T C 10: 67,059,875 (GRCm39) S641P probably damaging Het
Klhl33 T C 14: 51,130,385 (GRCm39) T110A probably benign Het
Lcorl T A 5: 45,890,968 (GRCm39) K545* probably null Het
Lilra6 A G 7: 3,914,628 (GRCm39) S546P probably damaging Het
Ly6c1 T A 15: 74,916,471 (GRCm39) I124F probably benign Het
Map4 A G 9: 109,897,847 (GRCm39) T858A probably benign Het
Marchf5 G T 19: 37,185,264 (GRCm39) probably benign Het
Muc2 A G 7: 141,307,157 (GRCm39) K769E Het
Myh6 T A 14: 55,200,992 (GRCm39) I157F probably damaging Het
Naip1 A G 13: 100,563,994 (GRCm39) V389A probably benign Het
Or52b3 G A 7: 102,204,397 (GRCm39) R302H possibly damaging Het
Pcdhgc4 A G 18: 37,949,640 (GRCm39) H352R probably benign Het
Pde8a C T 7: 80,982,619 (GRCm39) T746I probably damaging Het
Pick1 T C 15: 79,123,848 (GRCm39) V73A probably damaging Het
Ppwd1 C T 13: 104,342,080 (GRCm39) V625I probably benign Het
Prss59 A G 6: 40,905,473 (GRCm39) V61A probably damaging Het
Prune2 A G 19: 17,099,986 (GRCm39) E1830G probably benign Het
Ralgapb A G 2: 158,279,313 (GRCm39) N445S possibly damaging Het
Rapgef6 G T 11: 54,510,749 (GRCm39) R222L possibly damaging Het
Rorc A T 3: 94,280,170 (GRCm39) probably benign Het
Rps6ka1 A C 4: 133,594,432 (GRCm39) probably null Het
Sdk2 T C 11: 113,725,757 (GRCm39) Y1164C probably benign Het
Sema5a T A 15: 32,562,902 (GRCm39) Y304* probably null Het
Slc26a4 A T 12: 31,585,255 (GRCm39) V513D possibly damaging Het
Slf2 T A 19: 44,936,471 (GRCm39) D705E probably damaging Het
Spag17 A G 3: 99,934,905 (GRCm39) T704A probably benign Het
Tex15 C G 8: 34,063,344 (GRCm39) Q925E possibly damaging Het
Trim38 A T 13: 23,969,875 (GRCm39) T145S probably benign Het
Trpm3 G A 19: 22,425,696 (GRCm39) C17Y probably benign Het
Usp42 A G 5: 143,701,027 (GRCm39) Y999H probably benign Het
Vat1 A C 11: 101,351,441 (GRCm39) M300R probably benign Het
Vmn1r85 T A 7: 12,818,725 (GRCm39) I140F probably damaging Het
Vmn2r57 T C 7: 41,049,663 (GRCm39) I695M probably benign Het
Wnk1 C T 6: 119,942,660 (GRCm39) R789Q unknown Het
Zswim5 G A 4: 116,844,232 (GRCm39) G1090D probably damaging Het
Other mutations in Igfbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Igfbpl1 APN 4 45,826,478 (GRCm39) missense probably damaging 0.99
IGL03339:Igfbpl1 APN 4 45,813,555 (GRCm39) splice site probably benign
PIT1430001:Igfbpl1 UTSW 4 45,826,756 (GRCm39) missense unknown
PIT4504001:Igfbpl1 UTSW 4 45,813,469 (GRCm39) missense possibly damaging 0.86
R1824:Igfbpl1 UTSW 4 45,826,406 (GRCm39) missense probably benign 0.19
R2655:Igfbpl1 UTSW 4 45,816,289 (GRCm39) missense probably damaging 0.96
R3850:Igfbpl1 UTSW 4 45,826,426 (GRCm39) missense probably benign 0.02
R5431:Igfbpl1 UTSW 4 45,815,588 (GRCm39) missense probably benign 0.21
R5695:Igfbpl1 UTSW 4 45,826,374 (GRCm39) missense probably damaging 1.00
R6229:Igfbpl1 UTSW 4 45,813,517 (GRCm39) missense probably damaging 1.00
R6613:Igfbpl1 UTSW 4 45,813,447 (GRCm39) missense probably benign 0.00
R6950:Igfbpl1 UTSW 4 45,815,494 (GRCm39) missense probably damaging 1.00
R6954:Igfbpl1 UTSW 4 45,826,663 (GRCm39) missense probably damaging 1.00
R6971:Igfbpl1 UTSW 4 45,816,333 (GRCm39) missense possibly damaging 0.72
R7558:Igfbpl1 UTSW 4 45,813,497 (GRCm39) missense probably damaging 1.00
R7976:Igfbpl1 UTSW 4 45,826,786 (GRCm39) missense unknown
R8675:Igfbpl1 UTSW 4 45,813,469 (GRCm39) missense possibly damaging 0.86
R9394:Igfbpl1 UTSW 4 45,826,792 (GRCm39) start codon destroyed probably null
R9598:Igfbpl1 UTSW 4 45,815,472 (GRCm39) missense probably null 0.98
Predicted Primers PCR Primer
(F):5'- ACTGTTTACCACCCACAGGC -3'
(R):5'- CACTGACCACTGGAAATGGC -3'

Sequencing Primer
(F):5'- ACAGGCCCCTTCTGATGCTG -3'
(R):5'- TCCATTATCATCAAGGTGGGAGC -3'
Posted On 2022-04-18