Mutagenetix > Incidental Mutation

Incidental Mutation 'R9354:Muc2'

708270

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R9354 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141753420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 769 (K769E)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000026590
AA Change: K330E

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: K330E

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	G	6: 40,928,539	V61A	probably damaging	Het
4933409G03Rik	A	G	2: 68,606,529	Q181R	unknown	Het
Acsl1	T	G	8: 46,513,716	C242G	probably benign	Het
Agap2	A	C	10: 127,087,235	N646T	unknown	Het
Ankrd44	A	T	1: 54,648,279	*994R	probably null	Het
Apol7c	C	T	15: 77,525,912	R278H	possibly damaging	Het
Birc6	A	G	17: 74,614,406	E2166G	probably benign	Het
Caskin2	G	A	11: 115,802,642	T528M	probably damaging	Het
Ccdc30	G	T	4: 119,373,653	P15Q	possibly damaging	Het
Cenpf	G	A	1: 189,646,917	T45I		Het
Cep68	T	C	11: 20,238,569	E612G	probably damaging	Het
Chpf2	T	C	5: 24,591,394	L446P	probably damaging	Het
Ctsl	A	T	13: 64,369,036	Y40N	probably damaging	Het
Dis3l	T	C	9: 64,314,640	N496S	probably benign	Het
Espnl	A	T	1: 91,344,601	D561V	probably benign	Het
Flnb	T	A	14: 7,818,411	L87Q	probably benign	Het
Gbp9	T	A	5: 105,084,959	I276F	possibly damaging	Het
Gid4	G	T	11: 60,417,792	R46L	probably benign	Het
Gper1	G	A	5: 139,426,274	D125N	possibly damaging	Het
Gpr146	A	G	5: 139,392,611	N56S	probably benign	Het
Grhpr	G	T	4: 44,981,465	R5L	probably benign	Het
Gstm6	A	T	3: 107,942,702	N59K	probably damaging	Het
Hdac7	A	T	15: 97,796,888	F802L	probably damaging	Het
Igfbpl1	A	T	4: 45,816,348	V159D	probably damaging	Het
Itga8	T	C	2: 12,232,857	S351G	possibly damaging	Het
Itgad	C	A	7: 128,185,974	H354Q	probably damaging	Het
Jmjd1c	T	C	10: 67,224,096	S641P	probably damaging	Het
Klhl33	T	C	14: 50,892,928	T110A	probably benign	Het
Lcorl	T	A	5: 45,733,626	K545*	probably null	Het
Lilra6	A	G	7: 3,911,629	S546P	probably damaging	Het
Ly6c1	T	A	15: 75,044,622	I124F	probably benign	Het
Map4	A	G	9: 110,068,779	T858A	probably benign	Het
March5	G	T	19: 37,207,865		probably benign	Het
Myh6	T	A	14: 54,963,535	I157F	probably damaging	Het
Naip1	A	G	13: 100,427,486	V389A	probably benign	Het
Olfr549	G	A	7: 102,555,190	R302H	possibly damaging	Het
Pcdhgc4	A	G	18: 37,816,587	H352R	probably benign	Het
Pde8a	C	T	7: 81,332,871	T746I	probably damaging	Het
Pick1	T	C	15: 79,239,648	V73A	probably damaging	Het
Ppwd1	C	T	13: 104,205,572	V625I	probably benign	Het
Prune2	A	G	19: 17,122,622	E1830G	probably benign	Het
Ralgapb	A	G	2: 158,437,393	N445S	possibly damaging	Het
Rapgef6	G	T	11: 54,619,923	R222L	possibly damaging	Het
Rorc	A	T	3: 94,372,863		probably benign	Het
Rps6ka1	A	C	4: 133,867,121		probably null	Het
Sdk2	T	C	11: 113,834,931	Y1164C	probably benign	Het
Sema5a	T	A	15: 32,562,756	Y304*	probably null	Het
Slc26a4	A	T	12: 31,535,256	V513D	possibly damaging	Het
Slf2	T	A	19: 44,948,032	D705E	probably damaging	Het
Spag17	A	G	3: 100,027,589	T704A	probably benign	Het
Tex15	C	G	8: 33,573,316	Q925E	possibly damaging	Het
Tmem2	A	G	19: 21,802,025	S400G	probably benign	Het
Trim38	A	T	13: 23,785,892	T145S	probably benign	Het
Trpm3	G	A	19: 22,448,332	C17Y	probably benign	Het
Usp42	A	G	5: 143,715,272	Y999H	probably benign	Het
Vat1	A	C	11: 101,460,615	M300R	probably benign	Het
Vmn1r85	T	A	7: 13,084,798	I140F	probably damaging	Het
Vmn2r57	T	C	7: 41,400,239	I695M	probably benign	Het
Wnk1	C	T	6: 119,965,699	R789Q	unknown	Het
Zswim5	G	A	4: 116,987,035	G1090D	probably damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- ATCTCCAAGACTGTAACGGATG -3'
(R):5'- CCCTTCTTGTCATGGGATGC -3'

Sequencing Primer
(F):5'- ACTGTAACGGATGCCACTTG -3'
(R):5'- CCCTTCTTGTCATGGGATGCATAAG -3'

Posted On

2022-04-18