Incidental Mutation 'R9354:Ppwd1'
ID 708287
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Name peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms 4632422M10Rik, A330090G21Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R9354 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 104341632-104365351 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 104342080 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 625 (V625I)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022225] [ENSMUST00000022226] [ENSMUST00000069174] [ENSMUST00000069187]
AlphaFold Q8CEC6
Predicted Effect probably benign
Transcript: ENSMUST00000022225
SMART Domains Protein: ENSMUSP00000022225
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 1.32e-4 SMART
BBC 226 370 2.89e-41 SMART
ARF 387 569 1.15e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022226
AA Change: V625I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: V625I

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069174
SMART Domains Protein: ENSMUSP00000069371
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 11 55 3.07e-5 SMART
BBOX 102 148 3.07e-1 SMART
BBOX 153 199 1.32e-4 SMART
BBC 206 350 2.89e-41 SMART
ARF 367 549 1.15e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069187
SMART Domains Protein: ENSMUSP00000070767
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 5.95e-3 SMART
BBC 182 309 8.07e-22 SMART
ARF 326 508 1.15e-78 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,436,873 (GRCm39) Q181R unknown Het
Acsl1 T G 8: 46,966,753 (GRCm39) C242G probably benign Het
Agap2 A C 10: 126,923,104 (GRCm39) N646T unknown Het
Ankrd44 A T 1: 54,687,438 (GRCm39) *994R probably null Het
Apol7c C T 15: 77,410,112 (GRCm39) R278H possibly damaging Het
Birc6 A G 17: 74,921,401 (GRCm39) E2166G probably benign Het
Caskin2 G A 11: 115,693,468 (GRCm39) T528M probably damaging Het
Ccdc30 G T 4: 119,230,850 (GRCm39) P15Q possibly damaging Het
Cemip2 A G 19: 21,779,389 (GRCm39) S400G probably benign Het
Cenpf G A 1: 189,379,114 (GRCm39) T45I Het
Cep68 T C 11: 20,188,569 (GRCm39) E612G probably damaging Het
Chpf2 T C 5: 24,796,392 (GRCm39) L446P probably damaging Het
Ctsl A T 13: 64,516,850 (GRCm39) Y40N probably damaging Het
Dis3l T C 9: 64,221,922 (GRCm39) N496S probably benign Het
Espnl A T 1: 91,272,323 (GRCm39) D561V probably benign Het
Flnb T A 14: 7,818,411 (GRCm38) L87Q probably benign Het
Gbp9 T A 5: 105,232,825 (GRCm39) I276F possibly damaging Het
Gid4 G T 11: 60,308,618 (GRCm39) R46L probably benign Het
Gper1 G A 5: 139,412,029 (GRCm39) D125N possibly damaging Het
Gpr146 A G 5: 139,378,366 (GRCm39) N56S probably benign Het
Grhpr G T 4: 44,981,465 (GRCm39) R5L probably benign Het
Gstm6 A T 3: 107,850,018 (GRCm39) N59K probably damaging Het
Hdac7 A T 15: 97,694,769 (GRCm39) F802L probably damaging Het
Igfbpl1 A T 4: 45,816,348 (GRCm39) V159D probably damaging Het
Itga8 T C 2: 12,237,668 (GRCm39) S351G possibly damaging Het
Itgad C A 7: 127,785,146 (GRCm39) H354Q probably damaging Het
Jmjd1c T C 10: 67,059,875 (GRCm39) S641P probably damaging Het
Klhl33 T C 14: 51,130,385 (GRCm39) T110A probably benign Het
Lcorl T A 5: 45,890,968 (GRCm39) K545* probably null Het
Lilra6 A G 7: 3,914,628 (GRCm39) S546P probably damaging Het
Ly6c1 T A 15: 74,916,471 (GRCm39) I124F probably benign Het
Map4 A G 9: 109,897,847 (GRCm39) T858A probably benign Het
Marchf5 G T 19: 37,185,264 (GRCm39) probably benign Het
Muc2 A G 7: 141,307,157 (GRCm39) K769E Het
Myh6 T A 14: 55,200,992 (GRCm39) I157F probably damaging Het
Naip1 A G 13: 100,563,994 (GRCm39) V389A probably benign Het
Or52b3 G A 7: 102,204,397 (GRCm39) R302H possibly damaging Het
Pcdhgc4 A G 18: 37,949,640 (GRCm39) H352R probably benign Het
Pde8a C T 7: 80,982,619 (GRCm39) T746I probably damaging Het
Pick1 T C 15: 79,123,848 (GRCm39) V73A probably damaging Het
Prss59 A G 6: 40,905,473 (GRCm39) V61A probably damaging Het
Prune2 A G 19: 17,099,986 (GRCm39) E1830G probably benign Het
Ralgapb A G 2: 158,279,313 (GRCm39) N445S possibly damaging Het
Rapgef6 G T 11: 54,510,749 (GRCm39) R222L possibly damaging Het
Rorc A T 3: 94,280,170 (GRCm39) probably benign Het
Rps6ka1 A C 4: 133,594,432 (GRCm39) probably null Het
Sdk2 T C 11: 113,725,757 (GRCm39) Y1164C probably benign Het
Sema5a T A 15: 32,562,902 (GRCm39) Y304* probably null Het
Slc26a4 A T 12: 31,585,255 (GRCm39) V513D possibly damaging Het
Slf2 T A 19: 44,936,471 (GRCm39) D705E probably damaging Het
Spag17 A G 3: 99,934,905 (GRCm39) T704A probably benign Het
Tex15 C G 8: 34,063,344 (GRCm39) Q925E possibly damaging Het
Trim38 A T 13: 23,969,875 (GRCm39) T145S probably benign Het
Trpm3 G A 19: 22,425,696 (GRCm39) C17Y probably benign Het
Usp42 A G 5: 143,701,027 (GRCm39) Y999H probably benign Het
Vat1 A C 11: 101,351,441 (GRCm39) M300R probably benign Het
Vmn1r85 T A 7: 12,818,725 (GRCm39) I140F probably damaging Het
Vmn2r57 T C 7: 41,049,663 (GRCm39) I695M probably benign Het
Wnk1 C T 6: 119,942,660 (GRCm39) R789Q unknown Het
Zswim5 G A 4: 116,844,232 (GRCm39) G1090D probably damaging Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104,353,651 (GRCm39) missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104,350,212 (GRCm39) missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104,356,972 (GRCm39) missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104,353,624 (GRCm39) missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104,359,645 (GRCm39) missense probably benign
IGL02803:Ppwd1 APN 13 104,350,192 (GRCm39) missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104,346,261 (GRCm39) missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104,356,745 (GRCm39) missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104,359,468 (GRCm39) critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104,356,771 (GRCm39) missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104,343,650 (GRCm39) missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104,353,753 (GRCm39) missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104,356,571 (GRCm39) missense probably benign
R2353:Ppwd1 UTSW 13 104,350,090 (GRCm39) missense probably benign
R2382:Ppwd1 UTSW 13 104,343,621 (GRCm39) missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104,350,198 (GRCm39) missense possibly damaging 0.90
R4521:Ppwd1 UTSW 13 104,346,167 (GRCm39) missense probably benign 0.16
R4972:Ppwd1 UTSW 13 104,356,616 (GRCm39) missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104,356,943 (GRCm39) missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104,356,943 (GRCm39) missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104,361,952 (GRCm39) missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104,356,906 (GRCm39) missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104,344,538 (GRCm39) nonsense probably null
R7095:Ppwd1 UTSW 13 104,342,134 (GRCm39) missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104,343,680 (GRCm39) missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104,350,106 (GRCm39) missense probably damaging 0.99
R7664:Ppwd1 UTSW 13 104,356,798 (GRCm39) missense probably damaging 1.00
R7746:Ppwd1 UTSW 13 104,353,714 (GRCm39) missense probably damaging 1.00
R9259:Ppwd1 UTSW 13 104,359,612 (GRCm39) missense probably damaging 1.00
R9408:Ppwd1 UTSW 13 104,346,155 (GRCm39) missense possibly damaging 0.74
V7580:Ppwd1 UTSW 13 104,356,745 (GRCm39) missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104,356,745 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTACCCCTGAGAATCACAAATAGTC -3'
(R):5'- GTGGTGGGTAGTCTAATTCCCC -3'

Sequencing Primer
(F):5'- TCACAAATAGTCCAGAAAAGGCAGTG -3'
(R):5'- TGGGTAGTCTAATTCCCCCAGGG -3'
Posted On 2022-04-18