Incidental Mutation 'R9354:Ppwd1'
ID 708287
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Name peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms 4632422M10Rik, A330090G21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock # R9354 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 104205124-104228843 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 104205572 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 625 (V625I)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022225] [ENSMUST00000022226] [ENSMUST00000069174] [ENSMUST00000069187]
AlphaFold Q8CEC6
Predicted Effect probably benign
Transcript: ENSMUST00000022225
SMART Domains Protein: ENSMUSP00000022225
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 1.32e-4 SMART
BBC 226 370 2.89e-41 SMART
ARF 387 569 1.15e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022226
AA Change: V625I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: V625I

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069174
SMART Domains Protein: ENSMUSP00000069371
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 11 55 3.07e-5 SMART
BBOX 102 148 3.07e-1 SMART
BBOX 153 199 1.32e-4 SMART
BBC 206 350 2.89e-41 SMART
ARF 367 549 1.15e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069187
SMART Domains Protein: ENSMUSP00000070767
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 5.95e-3 SMART
BBC 182 309 8.07e-22 SMART
ARF 326 508 1.15e-78 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,539 V61A probably damaging Het
4933409G03Rik A G 2: 68,606,529 Q181R unknown Het
Acsl1 T G 8: 46,513,716 C242G probably benign Het
Agap2 A C 10: 127,087,235 N646T unknown Het
Ankrd44 A T 1: 54,648,279 *994R probably null Het
Apol7c C T 15: 77,525,912 R278H possibly damaging Het
Birc6 A G 17: 74,614,406 E2166G probably benign Het
Caskin2 G A 11: 115,802,642 T528M probably damaging Het
Ccdc30 G T 4: 119,373,653 P15Q possibly damaging Het
Cenpf G A 1: 189,646,917 T45I Het
Cep68 T C 11: 20,238,569 E612G probably damaging Het
Chpf2 T C 5: 24,591,394 L446P probably damaging Het
Ctsl A T 13: 64,369,036 Y40N probably damaging Het
Dis3l T C 9: 64,314,640 N496S probably benign Het
Espnl A T 1: 91,344,601 D561V probably benign Het
Flnb T A 14: 7,818,411 L87Q probably benign Het
Gbp9 T A 5: 105,084,959 I276F possibly damaging Het
Gid4 G T 11: 60,417,792 R46L probably benign Het
Gper1 G A 5: 139,426,274 D125N possibly damaging Het
Gpr146 A G 5: 139,392,611 N56S probably benign Het
Grhpr G T 4: 44,981,465 R5L probably benign Het
Gstm6 A T 3: 107,942,702 N59K probably damaging Het
Hdac7 A T 15: 97,796,888 F802L probably damaging Het
Igfbpl1 A T 4: 45,816,348 V159D probably damaging Het
Itga8 T C 2: 12,232,857 S351G possibly damaging Het
Itgad C A 7: 128,185,974 H354Q probably damaging Het
Jmjd1c T C 10: 67,224,096 S641P probably damaging Het
Klhl33 T C 14: 50,892,928 T110A probably benign Het
Lcorl T A 5: 45,733,626 K545* probably null Het
Lilra6 A G 7: 3,911,629 S546P probably damaging Het
Ly6c1 T A 15: 75,044,622 I124F probably benign Het
Map4 A G 9: 110,068,779 T858A probably benign Het
March5 G T 19: 37,207,865 probably benign Het
Muc2 A G 7: 141,753,420 K769E Het
Myh6 T A 14: 54,963,535 I157F probably damaging Het
Naip1 A G 13: 100,427,486 V389A probably benign Het
Olfr549 G A 7: 102,555,190 R302H possibly damaging Het
Pcdhgc4 A G 18: 37,816,587 H352R probably benign Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pick1 T C 15: 79,239,648 V73A probably damaging Het
Prune2 A G 19: 17,122,622 E1830G probably benign Het
Ralgapb A G 2: 158,437,393 N445S possibly damaging Het
Rapgef6 G T 11: 54,619,923 R222L possibly damaging Het
Rorc A T 3: 94,372,863 probably benign Het
Rps6ka1 A C 4: 133,867,121 probably null Het
Sdk2 T C 11: 113,834,931 Y1164C probably benign Het
Sema5a T A 15: 32,562,756 Y304* probably null Het
Slc26a4 A T 12: 31,535,256 V513D possibly damaging Het
Slf2 T A 19: 44,948,032 D705E probably damaging Het
Spag17 A G 3: 100,027,589 T704A probably benign Het
Tex15 C G 8: 33,573,316 Q925E possibly damaging Het
Tmem2 A G 19: 21,802,025 S400G probably benign Het
Trim38 A T 13: 23,785,892 T145S probably benign Het
Trpm3 G A 19: 22,448,332 C17Y probably benign Het
Usp42 A G 5: 143,715,272 Y999H probably benign Het
Vat1 A C 11: 101,460,615 M300R probably benign Het
Vmn1r85 T A 7: 13,084,798 I140F probably damaging Het
Vmn2r57 T C 7: 41,400,239 I695M probably benign Het
Wnk1 C T 6: 119,965,699 R789Q unknown Het
Zswim5 G A 4: 116,987,035 G1090D probably damaging Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104217143 missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104213704 missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104220464 missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104217116 missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104223137 missense probably benign
IGL02803:Ppwd1 APN 13 104213684 missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104209753 missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104222960 critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104220263 missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104207142 missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104217245 missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104220063 missense probably benign
R2353:Ppwd1 UTSW 13 104213582 missense probably benign
R2382:Ppwd1 UTSW 13 104207113 missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104213690 missense possibly damaging 0.90
R4521:Ppwd1 UTSW 13 104209659 missense probably benign 0.16
R4972:Ppwd1 UTSW 13 104220108 missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104225444 missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104220398 missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104208030 nonsense probably null
R7095:Ppwd1 UTSW 13 104205626 missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104207172 missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104213598 missense probably damaging 0.99
R7664:Ppwd1 UTSW 13 104220290 missense probably damaging 1.00
R7746:Ppwd1 UTSW 13 104217206 missense probably damaging 1.00
R9259:Ppwd1 UTSW 13 104223104 missense probably damaging 1.00
R9408:Ppwd1 UTSW 13 104209647 missense possibly damaging 0.74
V7580:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTACCCCTGAGAATCACAAATAGTC -3'
(R):5'- GTGGTGGGTAGTCTAATTCCCC -3'

Sequencing Primer
(F):5'- TCACAAATAGTCCAGAAAAGGCAGTG -3'
(R):5'- TGGGTAGTCTAATTCCCCCAGGG -3'
Posted On 2022-04-18