Incidental Mutation 'R9354:Slf2'
ID 708302
Institutional Source Beutler Lab
Gene Symbol Slf2
Ensembl Gene ENSMUSG00000036097
Gene Name SMC5-SMC6 complex localization factor 2
Synonyms Fam178a, 6030443O07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock # R9354 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 44931119-44983787 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44948032 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 705 (D705E)
Ref Sequence ENSEMBL: ENSMUSP00000093758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096053]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000096053
AA Change: D705E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093758
Gene: ENSMUSG00000036097
AA Change: D705E

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
low complexity region 211 226 N/A INTRINSIC
coiled coil region 239 266 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
low complexity region 572 582 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
Pfam:FAM178 647 1021 3.9e-146 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,539 V61A probably damaging Het
4933409G03Rik A G 2: 68,606,529 Q181R unknown Het
Acsl1 T G 8: 46,513,716 C242G probably benign Het
Agap2 A C 10: 127,087,235 N646T unknown Het
Ankrd44 A T 1: 54,648,279 *994R probably null Het
Apol7c C T 15: 77,525,912 R278H possibly damaging Het
Birc6 A G 17: 74,614,406 E2166G probably benign Het
Caskin2 G A 11: 115,802,642 T528M probably damaging Het
Ccdc30 G T 4: 119,373,653 P15Q possibly damaging Het
Cenpf G A 1: 189,646,917 T45I Het
Cep68 T C 11: 20,238,569 E612G probably damaging Het
Chpf2 T C 5: 24,591,394 L446P probably damaging Het
Ctsl A T 13: 64,369,036 Y40N probably damaging Het
Dis3l T C 9: 64,314,640 N496S probably benign Het
Espnl A T 1: 91,344,601 D561V probably benign Het
Flnb T A 14: 7,818,411 L87Q probably benign Het
Gbp9 T A 5: 105,084,959 I276F possibly damaging Het
Gid4 G T 11: 60,417,792 R46L probably benign Het
Gper1 G A 5: 139,426,274 D125N possibly damaging Het
Gpr146 A G 5: 139,392,611 N56S probably benign Het
Grhpr G T 4: 44,981,465 R5L probably benign Het
Gstm6 A T 3: 107,942,702 N59K probably damaging Het
Hdac7 A T 15: 97,796,888 F802L probably damaging Het
Igfbpl1 A T 4: 45,816,348 V159D probably damaging Het
Itga8 T C 2: 12,232,857 S351G possibly damaging Het
Itgad C A 7: 128,185,974 H354Q probably damaging Het
Jmjd1c T C 10: 67,224,096 S641P probably damaging Het
Klhl33 T C 14: 50,892,928 T110A probably benign Het
Lcorl T A 5: 45,733,626 K545* probably null Het
Lilra6 A G 7: 3,911,629 S546P probably damaging Het
Ly6c1 T A 15: 75,044,622 I124F probably benign Het
Map4 A G 9: 110,068,779 T858A probably benign Het
March5 G T 19: 37,207,865 probably benign Het
Muc2 A G 7: 141,753,420 K769E Het
Myh6 T A 14: 54,963,535 I157F probably damaging Het
Naip1 A G 13: 100,427,486 V389A probably benign Het
Olfr549 G A 7: 102,555,190 R302H possibly damaging Het
Pcdhgc4 A G 18: 37,816,587 H352R probably benign Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pick1 T C 15: 79,239,648 V73A probably damaging Het
Ppwd1 C T 13: 104,205,572 V625I probably benign Het
Prune2 A G 19: 17,122,622 E1830G probably benign Het
Ralgapb A G 2: 158,437,393 N445S possibly damaging Het
Rapgef6 G T 11: 54,619,923 R222L possibly damaging Het
Rorc A T 3: 94,372,863 probably benign Het
Rps6ka1 A C 4: 133,867,121 probably null Het
Sdk2 T C 11: 113,834,931 Y1164C probably benign Het
Sema5a T A 15: 32,562,756 Y304* probably null Het
Slc26a4 A T 12: 31,535,256 V513D possibly damaging Het
Spag17 A G 3: 100,027,589 T704A probably benign Het
Tex15 C G 8: 33,573,316 Q925E possibly damaging Het
Tmem2 A G 19: 21,802,025 S400G probably benign Het
Trim38 A T 13: 23,785,892 T145S probably benign Het
Trpm3 G A 19: 22,448,332 C17Y probably benign Het
Usp42 A G 5: 143,715,272 Y999H probably benign Het
Vat1 A C 11: 101,460,615 M300R probably benign Het
Vmn1r85 T A 7: 13,084,798 I140F probably damaging Het
Vmn2r57 T C 7: 41,400,239 I695M probably benign Het
Wnk1 C T 6: 119,965,699 R789Q unknown Het
Zswim5 G A 4: 116,987,035 G1090D probably damaging Het
Other mutations in Slf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Slf2 APN 19 44973267 critical splice donor site probably null
IGL01904:Slf2 APN 19 44949141 critical splice donor site probably null
IGL02429:Slf2 APN 19 44941728 missense probably benign
IGL02899:Slf2 APN 19 44942020 missense probably benign 0.26
Evidentiary UTSW 19 44938424 splice site probably null
BB004:Slf2 UTSW 19 44935301 missense probably damaging 0.97
BB014:Slf2 UTSW 19 44935301 missense probably damaging 0.97
R0060:Slf2 UTSW 19 44948004 missense probably damaging 1.00
R0731:Slf2 UTSW 19 44975726 splice site probably benign
R1158:Slf2 UTSW 19 44931416 missense probably damaging 0.99
R1590:Slf2 UTSW 19 44942073 nonsense probably null
R1608:Slf2 UTSW 19 44949001 missense probably benign 0.08
R1823:Slf2 UTSW 19 44935248 missense possibly damaging 0.86
R2511:Slf2 UTSW 19 44941606 missense possibly damaging 0.86
R3040:Slf2 UTSW 19 44980569 missense probably damaging 0.99
R3236:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3237:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3552:Slf2 UTSW 19 44934951 nonsense probably null
R3754:Slf2 UTSW 19 44973237 missense probably benign
R4683:Slf2 UTSW 19 44935481 missense probably benign 0.22
R4757:Slf2 UTSW 19 44935058 missense probably benign
R4782:Slf2 UTSW 19 44934925 splice site probably null
R4914:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4915:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4916:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4917:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4918:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R5069:Slf2 UTSW 19 44935253 missense possibly damaging 0.94
R5092:Slf2 UTSW 19 44952084 missense probably benign 0.14
R5215:Slf2 UTSW 19 44948037 missense probably damaging 0.99
R5276:Slf2 UTSW 19 44935161 missense possibly damaging 0.84
R5656:Slf2 UTSW 19 44973235 missense probably benign 0.13
R6132:Slf2 UTSW 19 44960861 missense possibly damaging 0.60
R6358:Slf2 UTSW 19 44935425 missense probably benign 0.34
R6481:Slf2 UTSW 19 44973164 missense probably benign 0.01
R6809:Slf2 UTSW 19 44943468 missense probably damaging 0.98
R7263:Slf2 UTSW 19 44938424 splice site probably null
R7912:Slf2 UTSW 19 44942243 missense probably damaging 0.96
R7914:Slf2 UTSW 19 44959060 missense possibly damaging 0.71
R7927:Slf2 UTSW 19 44935301 missense probably damaging 0.97
R8006:Slf2 UTSW 19 44942317 missense probably damaging 0.99
R8154:Slf2 UTSW 19 44935157 missense possibly damaging 0.94
R8746:Slf2 UTSW 19 44973624 missense probably damaging 1.00
R9075:Slf2 UTSW 19 44942421 missense probably damaging 0.99
R9352:Slf2 UTSW 19 44943518 missense probably null 0.97
R9369:Slf2 UTSW 19 44935514 nonsense probably null
R9412:Slf2 UTSW 19 44942021 missense probably benign 0.31
R9743:Slf2 UTSW 19 44942133 missense probably benign 0.40
R9778:Slf2 UTSW 19 44973227 missense probably benign 0.04
Z1176:Slf2 UTSW 19 44941665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTTAGATCACAGCAAAAGCTG -3'
(R):5'- GTGCTAACACTTAGGCTGTAACTTG -3'

Sequencing Primer
(F):5'- TCTCTGAATTAAGGCCAGGC -3'
(R):5'- ACTTAGGCTGTAACTTGGTTTTAATG -3'
Posted On 2022-04-18