Incidental Mutation 'R9355:Scn2a'
ID 708308
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9355 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65594433 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1761 (I1761F)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: I1761F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: I1761F

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: I1761F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: I1761F

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: I1761F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: I1761F

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano9 A G 7: 140,681,817 (GRCm39) V747A probably benign Het
Arfgef1 G A 1: 10,270,000 (GRCm39) P383L probably benign Het
Arhgef4 A G 1: 34,849,630 (GRCm39) E407G probably benign Het
Astn1 C T 1: 158,511,721 (GRCm39) L1188F probably damaging Het
Atg2b G A 12: 105,636,980 (GRCm39) P179S possibly damaging Het
Bcl9l G A 9: 44,419,000 (GRCm39) R983H probably benign Het
Bmp2k T A 5: 97,211,366 (GRCm39) Y511* probably null Het
C1galt1 G T 6: 7,866,474 (GRCm39) V107F probably damaging Het
Car3 T A 3: 14,928,664 (GRCm39) N11K Het
Ccdc170 A G 10: 4,508,695 (GRCm39) R640G probably benign Het
Cep126 A G 9: 8,100,038 (GRCm39) V832A possibly damaging Het
Ces1h C T 8: 94,101,149 (GRCm39) V49I Het
Clasp2 T A 9: 113,664,309 (GRCm39) V310D probably damaging Het
Comp C T 8: 70,828,699 (GRCm39) T177M probably benign Het
Coro1c T C 5: 114,003,726 (GRCm39) S98G probably damaging Het
Cpa6 C T 1: 10,479,520 (GRCm39) V238I probably benign Het
Crebrf T C 17: 26,962,094 (GRCm39) F397S probably damaging Het
Dcpp1 C A 17: 24,099,987 (GRCm39) Q3K possibly damaging Het
Dzip1l A G 9: 99,543,144 (GRCm39) D533G possibly damaging Het
Ecpas A T 4: 58,844,114 (GRCm39) S551T probably benign Het
Epha5 T C 5: 84,253,890 (GRCm39) E524G probably damaging Het
Epha7 A G 4: 28,935,806 (GRCm39) Y476C probably damaging Het
Erich5 G T 15: 34,471,001 (GRCm39) V77F probably damaging Het
Fat4 A G 3: 39,036,047 (GRCm39) Y3233C probably damaging Het
Ggt1 T A 10: 75,421,716 (GRCm39) V521E probably benign Het
Gm5431 A G 11: 48,785,275 (GRCm39) Y89H probably damaging Het
Gm5624 A T 14: 44,799,272 (GRCm39) L95* probably null Het
Gphn A G 12: 78,538,968 (GRCm39) T205A probably damaging Het
Grik5 C A 7: 24,767,597 (GRCm39) A28S possibly damaging Het
H2-K2 A G 17: 34,216,120 (GRCm39) S300P probably benign Het
H2-Oa T C 17: 34,313,723 (GRCm39) L227P possibly damaging Het
Hhip T C 8: 80,778,233 (GRCm39) N99S probably damaging Het
Hmcn2 A T 2: 31,328,302 (GRCm39) M4328L probably benign Het
Htt A T 5: 35,053,247 (GRCm39) M2527L probably benign Het
Impdh2 A T 9: 108,442,402 (GRCm39) H466L probably benign Het
Itgae G A 11: 73,006,906 (GRCm39) G384D probably damaging Het
Krt90 T C 15: 101,461,714 (GRCm39) S496G unknown Het
Krtap5-5 A G 7: 141,783,114 (GRCm39) S179P unknown Het
Lif C T 11: 4,219,044 (GRCm39) R63W probably damaging Het
Lrrc10 T C 10: 116,881,881 (GRCm39) V185A probably damaging Het
Lrrc27 A C 7: 138,822,648 (GRCm39) Q513P probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Map2k3 T C 11: 60,823,055 (GRCm39) S3P possibly damaging Het
Mc2r T C 18: 68,541,195 (GRCm39) T33A probably benign Het
Mefv T A 16: 3,525,882 (GRCm39) D795V probably damaging Het
Megf6 A T 4: 154,338,282 (GRCm39) R451W probably damaging Het
Mrpl21 G A 19: 3,336,937 (GRCm39) V103M probably damaging Het
Mtmr14 GCCGCCGCCTCGGCGGGTTCCACCGCCTCGTCGGGCAGCCCGCCGCCTC GCCGCCGCCTC 6: 113,214,948 (GRCm39) probably null Het
Myom1 T C 17: 71,384,888 (GRCm39) S760P probably damaging Het
Ndst4 A G 3: 125,403,246 (GRCm39) Y451C probably damaging Het
Nkain4 T C 2: 180,577,775 (GRCm39) N193S possibly damaging Het
Opa1 T A 16: 29,432,807 (GRCm39) L490H probably damaging Het
Opcml A C 9: 28,814,650 (GRCm39) I301L probably benign Het
Or10ak16 G A 4: 118,750,784 (GRCm39) S168N probably benign Het
Or1e33 A G 11: 73,738,643 (GRCm39) F103L probably damaging Het
Or4p23 A T 2: 88,576,749 (GRCm39) I161N probably damaging Het
Or52s19 T C 7: 103,008,125 (GRCm39) H92R probably benign Het
Pabpc1l T C 2: 163,884,469 (GRCm39) L402P probably benign Het
Palld C T 8: 61,969,691 (GRCm39) R1211H unknown Het
Peak1 G T 9: 56,167,454 (GRCm39) A158E probably damaging Het
Ppfibp2 C T 7: 107,322,169 (GRCm39) P406L probably benign Het
Qpctl T C 7: 18,875,146 (GRCm39) H362R probably damaging Het
Ripor2 A G 13: 24,885,694 (GRCm39) H643R probably benign Het
Scn11a A T 9: 119,584,160 (GRCm39) L1485Q probably damaging Het
Scrn3 A G 2: 73,166,077 (GRCm39) D370G probably benign Het
Sec24b A T 3: 129,787,489 (GRCm39) F877Y possibly damaging Het
Slc35f3 T C 8: 127,108,967 (GRCm39) I172T probably damaging Het
Smc3 T C 19: 53,622,544 (GRCm39) probably null Het
Smpd3 C T 8: 106,991,825 (GRCm39) V243M probably damaging Het
Sos1 T A 17: 80,722,479 (GRCm39) I856F possibly damaging Het
Sp2 A T 11: 96,852,231 (GRCm39) L231H possibly damaging Het
Syne1 T C 10: 5,318,255 (GRCm39) Y457C probably damaging Het
Tdpoz6 T C 3: 93,600,307 (GRCm39) T21A possibly damaging Het
Tekt5 T C 16: 10,213,268 (GRCm39) T6A possibly damaging Het
Tln2 G T 9: 67,262,529 (GRCm39) T574K possibly damaging Het
Tmem161a T C 8: 70,633,821 (GRCm39) S313P probably damaging Het
Trmt12 G A 15: 58,744,824 (GRCm39) C74Y probably damaging Het
Trpc6 A G 9: 8,649,473 (GRCm39) D561G probably benign Het
Ttn A G 2: 76,700,769 (GRCm39) V62A Het
Tubgcp5 T C 7: 55,467,177 (GRCm39) probably null Het
Unc13a C T 8: 72,098,375 (GRCm39) V1137M possibly damaging Het
Zfp729a A G 13: 67,767,515 (GRCm39) C905R probably damaging Het
Zfp735 A G 11: 73,602,362 (GRCm39) I435M probably benign Het
Zswim4 C A 8: 84,955,687 (GRCm39) G271W probably damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0335:Scn2a UTSW 2 65,512,435 (GRCm39) missense probably damaging 1.00
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1448:Scn2a UTSW 2 65,514,189 (GRCm39) missense probably benign 0.17
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4586:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7069:Scn2a UTSW 2 65,594,950 (GRCm39) missense probably benign 0.00
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7125:Scn2a UTSW 2 65,594,277 (GRCm39) missense probably damaging 1.00
R7178:Scn2a UTSW 2 65,579,197 (GRCm39) nonsense probably null
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7491:Scn2a UTSW 2 65,532,352 (GRCm39) missense probably damaging 0.99
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8416:Scn2a UTSW 2 65,511,345 (GRCm39) missense probably benign 0.00
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9657:Scn2a UTSW 2 65,566,032 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTTGGGATTGATGACATGTTCAAC -3'
(R):5'- GCTGCAAAGTCAGAGAGCTTG -3'

Sequencing Primer
(F):5'- CAACTTTGAGACCTTTGGCAAC -3'
(R):5'- GCTTGCAGAACTCTATGAACTGG -3'
Posted On 2022-04-18