Incidental Mutation 'R9355:Tubgcp5'
ID 708331
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Name tubulin, gamma complex component 5
Synonyms GCP5, B130010C12Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R9355 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 55443873-55481207 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 55467177 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]
AlphaFold Q8BKN5
Predicted Effect probably null
Transcript: ENSMUST00000032627
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205796
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano9 A G 7: 140,681,817 (GRCm39) V747A probably benign Het
Arfgef1 G A 1: 10,270,000 (GRCm39) P383L probably benign Het
Arhgef4 A G 1: 34,849,630 (GRCm39) E407G probably benign Het
Astn1 C T 1: 158,511,721 (GRCm39) L1188F probably damaging Het
Atg2b G A 12: 105,636,980 (GRCm39) P179S possibly damaging Het
Bcl9l G A 9: 44,419,000 (GRCm39) R983H probably benign Het
Bmp2k T A 5: 97,211,366 (GRCm39) Y511* probably null Het
C1galt1 G T 6: 7,866,474 (GRCm39) V107F probably damaging Het
Car3 T A 3: 14,928,664 (GRCm39) N11K Het
Ccdc170 A G 10: 4,508,695 (GRCm39) R640G probably benign Het
Cep126 A G 9: 8,100,038 (GRCm39) V832A possibly damaging Het
Ces1h C T 8: 94,101,149 (GRCm39) V49I Het
Clasp2 T A 9: 113,664,309 (GRCm39) V310D probably damaging Het
Comp C T 8: 70,828,699 (GRCm39) T177M probably benign Het
Coro1c T C 5: 114,003,726 (GRCm39) S98G probably damaging Het
Cpa6 C T 1: 10,479,520 (GRCm39) V238I probably benign Het
Crebrf T C 17: 26,962,094 (GRCm39) F397S probably damaging Het
Dcpp1 C A 17: 24,099,987 (GRCm39) Q3K possibly damaging Het
Dzip1l A G 9: 99,543,144 (GRCm39) D533G possibly damaging Het
Ecpas A T 4: 58,844,114 (GRCm39) S551T probably benign Het
Epha5 T C 5: 84,253,890 (GRCm39) E524G probably damaging Het
Epha7 A G 4: 28,935,806 (GRCm39) Y476C probably damaging Het
Erich5 G T 15: 34,471,001 (GRCm39) V77F probably damaging Het
Fat4 A G 3: 39,036,047 (GRCm39) Y3233C probably damaging Het
Ggt1 T A 10: 75,421,716 (GRCm39) V521E probably benign Het
Gm5431 A G 11: 48,785,275 (GRCm39) Y89H probably damaging Het
Gm5624 A T 14: 44,799,272 (GRCm39) L95* probably null Het
Gphn A G 12: 78,538,968 (GRCm39) T205A probably damaging Het
Grik5 C A 7: 24,767,597 (GRCm39) A28S possibly damaging Het
H2-K2 A G 17: 34,216,120 (GRCm39) S300P probably benign Het
H2-Oa T C 17: 34,313,723 (GRCm39) L227P possibly damaging Het
Hhip T C 8: 80,778,233 (GRCm39) N99S probably damaging Het
Hmcn2 A T 2: 31,328,302 (GRCm39) M4328L probably benign Het
Htt A T 5: 35,053,247 (GRCm39) M2527L probably benign Het
Impdh2 A T 9: 108,442,402 (GRCm39) H466L probably benign Het
Itgae G A 11: 73,006,906 (GRCm39) G384D probably damaging Het
Krt90 T C 15: 101,461,714 (GRCm39) S496G unknown Het
Krtap5-5 A G 7: 141,783,114 (GRCm39) S179P unknown Het
Lif C T 11: 4,219,044 (GRCm39) R63W probably damaging Het
Lrrc10 T C 10: 116,881,881 (GRCm39) V185A probably damaging Het
Lrrc27 A C 7: 138,822,648 (GRCm39) Q513P probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Map2k3 T C 11: 60,823,055 (GRCm39) S3P possibly damaging Het
Mc2r T C 18: 68,541,195 (GRCm39) T33A probably benign Het
Mefv T A 16: 3,525,882 (GRCm39) D795V probably damaging Het
Megf6 A T 4: 154,338,282 (GRCm39) R451W probably damaging Het
Mrpl21 G A 19: 3,336,937 (GRCm39) V103M probably damaging Het
Mtmr14 GCCGCCGCCTCGGCGGGTTCCACCGCCTCGTCGGGCAGCCCGCCGCCTC GCCGCCGCCTC 6: 113,214,948 (GRCm39) probably null Het
Myom1 T C 17: 71,384,888 (GRCm39) S760P probably damaging Het
Ndst4 A G 3: 125,403,246 (GRCm39) Y451C probably damaging Het
Nkain4 T C 2: 180,577,775 (GRCm39) N193S possibly damaging Het
Opa1 T A 16: 29,432,807 (GRCm39) L490H probably damaging Het
Opcml A C 9: 28,814,650 (GRCm39) I301L probably benign Het
Or10ak16 G A 4: 118,750,784 (GRCm39) S168N probably benign Het
Or1e33 A G 11: 73,738,643 (GRCm39) F103L probably damaging Het
Or4p23 A T 2: 88,576,749 (GRCm39) I161N probably damaging Het
Or52s19 T C 7: 103,008,125 (GRCm39) H92R probably benign Het
Pabpc1l T C 2: 163,884,469 (GRCm39) L402P probably benign Het
Palld C T 8: 61,969,691 (GRCm39) R1211H unknown Het
Peak1 G T 9: 56,167,454 (GRCm39) A158E probably damaging Het
Ppfibp2 C T 7: 107,322,169 (GRCm39) P406L probably benign Het
Qpctl T C 7: 18,875,146 (GRCm39) H362R probably damaging Het
Ripor2 A G 13: 24,885,694 (GRCm39) H643R probably benign Het
Scn11a A T 9: 119,584,160 (GRCm39) L1485Q probably damaging Het
Scn2a A T 2: 65,594,433 (GRCm39) I1761F probably damaging Het
Scrn3 A G 2: 73,166,077 (GRCm39) D370G probably benign Het
Sec24b A T 3: 129,787,489 (GRCm39) F877Y possibly damaging Het
Slc35f3 T C 8: 127,108,967 (GRCm39) I172T probably damaging Het
Smc3 T C 19: 53,622,544 (GRCm39) probably null Het
Smpd3 C T 8: 106,991,825 (GRCm39) V243M probably damaging Het
Sos1 T A 17: 80,722,479 (GRCm39) I856F possibly damaging Het
Sp2 A T 11: 96,852,231 (GRCm39) L231H possibly damaging Het
Syne1 T C 10: 5,318,255 (GRCm39) Y457C probably damaging Het
Tdpoz6 T C 3: 93,600,307 (GRCm39) T21A possibly damaging Het
Tekt5 T C 16: 10,213,268 (GRCm39) T6A possibly damaging Het
Tln2 G T 9: 67,262,529 (GRCm39) T574K possibly damaging Het
Tmem161a T C 8: 70,633,821 (GRCm39) S313P probably damaging Het
Trmt12 G A 15: 58,744,824 (GRCm39) C74Y probably damaging Het
Trpc6 A G 9: 8,649,473 (GRCm39) D561G probably benign Het
Ttn A G 2: 76,700,769 (GRCm39) V62A Het
Unc13a C T 8: 72,098,375 (GRCm39) V1137M possibly damaging Het
Zfp729a A G 13: 67,767,515 (GRCm39) C905R probably damaging Het
Zfp735 A G 11: 73,602,362 (GRCm39) I435M probably benign Het
Zswim4 C A 8: 84,955,687 (GRCm39) G271W probably damaging Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55,456,343 (GRCm39) missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55,458,277 (GRCm39) missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55,445,779 (GRCm39) splice site probably benign
IGL01597:Tubgcp5 APN 7 55,456,580 (GRCm39) splice site probably benign
IGL01688:Tubgcp5 APN 7 55,464,766 (GRCm39) missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55,449,221 (GRCm39) missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55,455,836 (GRCm39) missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55,468,505 (GRCm39) missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55,456,355 (GRCm39) nonsense probably null
IGL03105:Tubgcp5 APN 7 55,475,329 (GRCm39) missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55,458,277 (GRCm39) missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55,468,643 (GRCm39) missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55,464,726 (GRCm39) missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55,450,432 (GRCm39) missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55,473,315 (GRCm39) missense probably benign
R0488:Tubgcp5 UTSW 7 55,479,086 (GRCm39) missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55,464,599 (GRCm39) splice site probably benign
R0885:Tubgcp5 UTSW 7 55,455,803 (GRCm39) nonsense probably null
R1483:Tubgcp5 UTSW 7 55,475,455 (GRCm39) critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55,458,285 (GRCm39) missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55,464,768 (GRCm39) missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55,449,259 (GRCm39) missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55,480,629 (GRCm39) missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55,480,614 (GRCm39) missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55,455,077 (GRCm39) missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55,443,933 (GRCm39) unclassified probably benign
R4948:Tubgcp5 UTSW 7 55,455,871 (GRCm39) missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55,458,385 (GRCm39) missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55,473,433 (GRCm39) missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55,475,409 (GRCm39) missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55,455,077 (GRCm39) missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55,468,643 (GRCm39) missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55,464,710 (GRCm39) missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55,473,357 (GRCm39) missense probably benign
R6141:Tubgcp5 UTSW 7 55,456,526 (GRCm39) missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55,445,671 (GRCm39) missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55,467,140 (GRCm39) nonsense probably null
R6563:Tubgcp5 UTSW 7 55,475,409 (GRCm39) missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55,473,331 (GRCm39) missense probably benign
R6596:Tubgcp5 UTSW 7 55,456,382 (GRCm39) missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55,443,977 (GRCm39) missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55,455,114 (GRCm39) missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55,479,155 (GRCm39) missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55,450,443 (GRCm39) nonsense probably null
R7213:Tubgcp5 UTSW 7 55,455,860 (GRCm39) missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55,473,315 (GRCm39) missense probably benign
R7600:Tubgcp5 UTSW 7 55,458,261 (GRCm39) missense probably benign
R7813:Tubgcp5 UTSW 7 55,450,444 (GRCm39) missense possibly damaging 0.49
R7920:Tubgcp5 UTSW 7 55,466,310 (GRCm39) missense probably benign 0.00
R7948:Tubgcp5 UTSW 7 55,443,996 (GRCm39) missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55,454,363 (GRCm39) missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55,454,363 (GRCm39) missense possibly damaging 0.67
R9087:Tubgcp5 UTSW 7 55,467,106 (GRCm39) missense probably damaging 1.00
R9211:Tubgcp5 UTSW 7 55,456,331 (GRCm39) missense probably benign 0.05
R9269:Tubgcp5 UTSW 7 55,445,693 (GRCm39) missense possibly damaging 0.94
R9329:Tubgcp5 UTSW 7 55,479,181 (GRCm39) critical splice donor site probably null
R9498:Tubgcp5 UTSW 7 55,463,233 (GRCm39) missense possibly damaging 0.46
R9687:Tubgcp5 UTSW 7 55,475,327 (GRCm39) critical splice acceptor site probably null
Z1088:Tubgcp5 UTSW 7 55,464,849 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGACTTTCACGAGAAGTTTGC -3'
(R):5'- ACTGTGCATGTTCTGAGCG -3'

Sequencing Primer
(F):5'- ACTTTCACGAGAAGTTTGCTGGTG -3'
(R):5'- GGCTGTTCTTGAACTCAGAAATCCAC -3'
Posted On 2022-04-18