Incidental Mutation 'R9355:Scn11a'
ID 708355
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9355 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119584160 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1485 (L1485Q)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: L1485Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: L1485Q

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: L1485Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano9 A G 7: 140,681,817 (GRCm39) V747A probably benign Het
Arfgef1 G A 1: 10,270,000 (GRCm39) P383L probably benign Het
Arhgef4 A G 1: 34,849,630 (GRCm39) E407G probably benign Het
Astn1 C T 1: 158,511,721 (GRCm39) L1188F probably damaging Het
Atg2b G A 12: 105,636,980 (GRCm39) P179S possibly damaging Het
Bcl9l G A 9: 44,419,000 (GRCm39) R983H probably benign Het
Bmp2k T A 5: 97,211,366 (GRCm39) Y511* probably null Het
C1galt1 G T 6: 7,866,474 (GRCm39) V107F probably damaging Het
Car3 T A 3: 14,928,664 (GRCm39) N11K Het
Ccdc170 A G 10: 4,508,695 (GRCm39) R640G probably benign Het
Cep126 A G 9: 8,100,038 (GRCm39) V832A possibly damaging Het
Ces1h C T 8: 94,101,149 (GRCm39) V49I Het
Clasp2 T A 9: 113,664,309 (GRCm39) V310D probably damaging Het
Comp C T 8: 70,828,699 (GRCm39) T177M probably benign Het
Coro1c T C 5: 114,003,726 (GRCm39) S98G probably damaging Het
Cpa6 C T 1: 10,479,520 (GRCm39) V238I probably benign Het
Crebrf T C 17: 26,962,094 (GRCm39) F397S probably damaging Het
Dcpp1 C A 17: 24,099,987 (GRCm39) Q3K possibly damaging Het
Dzip1l A G 9: 99,543,144 (GRCm39) D533G possibly damaging Het
Ecpas A T 4: 58,844,114 (GRCm39) S551T probably benign Het
Epha5 T C 5: 84,253,890 (GRCm39) E524G probably damaging Het
Epha7 A G 4: 28,935,806 (GRCm39) Y476C probably damaging Het
Erich5 G T 15: 34,471,001 (GRCm39) V77F probably damaging Het
Fat4 A G 3: 39,036,047 (GRCm39) Y3233C probably damaging Het
Ggt1 T A 10: 75,421,716 (GRCm39) V521E probably benign Het
Gm5431 A G 11: 48,785,275 (GRCm39) Y89H probably damaging Het
Gm5624 A T 14: 44,799,272 (GRCm39) L95* probably null Het
Gphn A G 12: 78,538,968 (GRCm39) T205A probably damaging Het
Grik5 C A 7: 24,767,597 (GRCm39) A28S possibly damaging Het
H2-K2 A G 17: 34,216,120 (GRCm39) S300P probably benign Het
H2-Oa T C 17: 34,313,723 (GRCm39) L227P possibly damaging Het
Hhip T C 8: 80,778,233 (GRCm39) N99S probably damaging Het
Hmcn2 A T 2: 31,328,302 (GRCm39) M4328L probably benign Het
Htt A T 5: 35,053,247 (GRCm39) M2527L probably benign Het
Impdh2 A T 9: 108,442,402 (GRCm39) H466L probably benign Het
Itgae G A 11: 73,006,906 (GRCm39) G384D probably damaging Het
Krt90 T C 15: 101,461,714 (GRCm39) S496G unknown Het
Krtap5-5 A G 7: 141,783,114 (GRCm39) S179P unknown Het
Lif C T 11: 4,219,044 (GRCm39) R63W probably damaging Het
Lrrc10 T C 10: 116,881,881 (GRCm39) V185A probably damaging Het
Lrrc27 A C 7: 138,822,648 (GRCm39) Q513P probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Map2k3 T C 11: 60,823,055 (GRCm39) S3P possibly damaging Het
Mc2r T C 18: 68,541,195 (GRCm39) T33A probably benign Het
Mefv T A 16: 3,525,882 (GRCm39) D795V probably damaging Het
Megf6 A T 4: 154,338,282 (GRCm39) R451W probably damaging Het
Mrpl21 G A 19: 3,336,937 (GRCm39) V103M probably damaging Het
Mtmr14 GCCGCCGCCTCGGCGGGTTCCACCGCCTCGTCGGGCAGCCCGCCGCCTC GCCGCCGCCTC 6: 113,214,948 (GRCm39) probably null Het
Myom1 T C 17: 71,384,888 (GRCm39) S760P probably damaging Het
Ndst4 A G 3: 125,403,246 (GRCm39) Y451C probably damaging Het
Nkain4 T C 2: 180,577,775 (GRCm39) N193S possibly damaging Het
Opa1 T A 16: 29,432,807 (GRCm39) L490H probably damaging Het
Opcml A C 9: 28,814,650 (GRCm39) I301L probably benign Het
Or10ak16 G A 4: 118,750,784 (GRCm39) S168N probably benign Het
Or1e33 A G 11: 73,738,643 (GRCm39) F103L probably damaging Het
Or4p23 A T 2: 88,576,749 (GRCm39) I161N probably damaging Het
Or52s19 T C 7: 103,008,125 (GRCm39) H92R probably benign Het
Pabpc1l T C 2: 163,884,469 (GRCm39) L402P probably benign Het
Palld C T 8: 61,969,691 (GRCm39) R1211H unknown Het
Peak1 G T 9: 56,167,454 (GRCm39) A158E probably damaging Het
Ppfibp2 C T 7: 107,322,169 (GRCm39) P406L probably benign Het
Qpctl T C 7: 18,875,146 (GRCm39) H362R probably damaging Het
Ripor2 A G 13: 24,885,694 (GRCm39) H643R probably benign Het
Scn2a A T 2: 65,594,433 (GRCm39) I1761F probably damaging Het
Scrn3 A G 2: 73,166,077 (GRCm39) D370G probably benign Het
Sec24b A T 3: 129,787,489 (GRCm39) F877Y possibly damaging Het
Slc35f3 T C 8: 127,108,967 (GRCm39) I172T probably damaging Het
Smc3 T C 19: 53,622,544 (GRCm39) probably null Het
Smpd3 C T 8: 106,991,825 (GRCm39) V243M probably damaging Het
Sos1 T A 17: 80,722,479 (GRCm39) I856F possibly damaging Het
Sp2 A T 11: 96,852,231 (GRCm39) L231H possibly damaging Het
Syne1 T C 10: 5,318,255 (GRCm39) Y457C probably damaging Het
Tdpoz6 T C 3: 93,600,307 (GRCm39) T21A possibly damaging Het
Tekt5 T C 16: 10,213,268 (GRCm39) T6A possibly damaging Het
Tln2 G T 9: 67,262,529 (GRCm39) T574K possibly damaging Het
Tmem161a T C 8: 70,633,821 (GRCm39) S313P probably damaging Het
Trmt12 G A 15: 58,744,824 (GRCm39) C74Y probably damaging Het
Trpc6 A G 9: 8,649,473 (GRCm39) D561G probably benign Het
Ttn A G 2: 76,700,769 (GRCm39) V62A Het
Tubgcp5 T C 7: 55,467,177 (GRCm39) probably null Het
Unc13a C T 8: 72,098,375 (GRCm39) V1137M possibly damaging Het
Zfp729a A G 13: 67,767,515 (GRCm39) C905R probably damaging Het
Zfp735 A G 11: 73,602,362 (GRCm39) I435M probably benign Het
Zswim4 C A 8: 84,955,687 (GRCm39) G271W probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTCCAGCATGGGGTTGAG -3'
(R):5'- GGAAGCTGCAGTGCATGTTG -3'

Sequencing Primer
(F):5'- CATGGGGTTGAGGAGAGCATC -3'
(R):5'- CAGTGCATGTTGGGAACTCAC -3'
Posted On 2022-04-18