Mutagenetix > Incidental Mutation

Incidental Mutation 'R0744:Samd9l'

70843

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

038925-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0744 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3372725 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1512 (E1512G)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120087
AA Change: E1512G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: E1512G

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Meta Mutation Damage Score

0.3843

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

98% (91/93)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,165,069	L41P	probably damaging	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aebp2	T	G	6: 140,642,364		probably null	Het
AI987944	T	C	7: 41,376,859	Y6C	probably damaging	Het
Ascc3	T	C	10: 50,845,666	W2072R	probably benign	Het
Asxl3	A	G	18: 22,516,040	D362G	probably damaging	Het
Baiap2l1	T	A	5: 144,266,641	D479V	probably benign	Het
Bdp1	A	T	13: 100,035,825	H2094Q	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Cd226	A	C	18: 89,207,020		probably benign	Het
Clip1	T	C	5: 123,630,721	D605G	probably benign	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dzip3	A	G	16: 48,959,675	Y301H	probably damaging	Het
Ephb4	T	A	5: 137,365,667	N600K	probably damaging	Het
Erich6	T	A	3: 58,636,122		probably benign	Het
Fbn1	T	C	2: 125,314,814		probably benign	Het
Fryl	A	T	5: 73,089,081		probably benign	Het
Galnt17	T	A	5: 131,150,916	D131V	probably damaging	Het
Gm13089	A	T	4: 143,698,486	M129K	probably benign	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Gm6619	T	A	6: 131,490,334	L54Q	probably damaging	Het
Herc2	T	C	7: 56,206,036		probably benign	Het
Hic1	T	A	11: 75,165,801	Q754L	possibly damaging	Het
Hnf4g	A	T	3: 3,651,629	D286V	possibly damaging	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itih1	A	T	14: 30,941,555	V164E	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Lrfn5	A	C	12: 61,839,668	T81P	probably damaging	Het
Lrrc58	A	G	16: 37,878,573		probably benign	Het
March6	T	C	15: 31,480,291	Y562C	probably benign	Het
Mark1	T	A	1: 184,921,608	I166F	probably damaging	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mast4	C	G	13: 102,737,387	Q1632H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mgst3	A	G	1: 167,373,805	Y104H	probably damaging	Het
Mlxipl	C	T	5: 135,132,475	T416I	possibly damaging	Het
Mthfd2l	T	C	5: 90,946,942	V90A	probably damaging	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Muc1	C	A	3: 89,230,328	P159Q	possibly damaging	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Myt1	TGAGGAGGAGGAGGAGGAGG	TGAGGAGGAGGAGGAGG	2: 181,797,505		probably benign	Het
Olfr1513	T	C	14: 52,349,378	I223V	probably benign	Het
Olfr329-ps	T	A	11: 58,543,162	M105L	possibly damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Pdcd6	A	G	13: 74,316,324		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Pzp	A	G	6: 128,516,195		probably benign	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapgef3	G	A	15: 97,761,585		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rgs11	T	A	17: 26,203,318	M29K	probably damaging	Het
Rictor	A	G	15: 6,764,278		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Sgsm1	C	T	5: 113,279,184	A127T	probably benign	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc26a1	T	A	5: 108,673,523	T167S	probably benign	Het
Slc2a12	T	C	10: 22,702,016		probably benign	Het
Slc44a5	T	C	3: 154,265,474	S654P	probably damaging	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Slc6a13	T	G	6: 121,302,867	W67G	probably damaging	Het
Sowahc	GGGAGGAGGAGGAGGAGGAGGAGGAGGA	GGGAGGAGGAGGAGGAGGAGGAGGA	10: 59,223,491		probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Supt20	T	A	3: 54,714,701	Y409N	probably damaging	Het
Synrg	C	T	11: 84,024,305	Q1046*	probably null	Het
Tab2	T	C	10: 7,907,581		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm6	T	C	2: 130,151,761	V640A	probably benign	Het
Tle2	T	C	10: 81,588,947	F667L	probably damaging	Het
Tnfaip3	C	A	10: 19,002,949	A704S	probably benign	Het
Tomm34	T	C	2: 164,070,976	N22D	probably benign	Het
Trabd2b	A	G	4: 114,580,322	Q232R	probably benign	Het
Trim62	A	G	4: 128,884,215	S16G	probably damaging	Het
Ttc28	T	A	5: 111,231,081	I1144N	probably damaging	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Ush2a	C	T	1: 188,814,406		probably benign	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zbed5	T	A	5: 129,902,272	V354E	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAGAGGACCCTCAATGGAAAATC -3'
(R):5'- GCAACTGTCAAAGGTGCTGACCAAG -3'

Sequencing Primer
(F):5'- CCACTTCTGAGTGGAGCTGAAT -3'
(R):5'- GTTGTCTAAAGCCCAGTTCCAAG -3'

Posted On

2013-09-30