Mutagenetix > Incidental Mutation

Incidental Mutation 'R9356:Ints9'

708433

Institutional Source

Beutler Lab

Gene Symbol

Ints9

Ensembl Gene

ENSMUSG00000021975

Gene Name

integrator complex subunit 9

Synonyms

D14Ertd231e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9356 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64950045-65039832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65032321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 487 (S487P)

Ref Sequence

ENSEMBL: ENSMUSP00000045552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043914]

AlphaFold

Q8K114

Predicted Effect

probably benign
Transcript: ENSMUST00000043914
AA Change: S487P

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: S487P

Domain	Start	End	E-Value	Type
Pfam:Lactamase_B_6	91	289	1.2e-17	PFAM
Beta-Casp	334	462	7.65e-16	SMART
low complexity region	583	596	N/A	INTRINSIC
low complexity region	672	682	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,289,323	K2618E	possibly damaging	Het
Abca13	G	A	11: 9,256,305	V202M	probably benign	Het
Ago3	A	T	4: 126,370,351	I354N	probably damaging	Het
Ankrd50	A	T	3: 38,456,087	D710E	probably damaging	Het
Apba2	A	T	7: 64,695,673	N204Y	probably damaging	Het
Arrdc4	A	G	7: 68,744,879	V139A	possibly damaging	Het
Baz1b	A	G	5: 135,210,799	E251G	probably benign	Het
Calcr	T	C	6: 3,687,408	D530G	probably benign	Het
Chrna7	A	T	7: 63,107,689	V154E	probably damaging	Het
Cldn15	T	C	5: 136,968,114	V3A	probably benign	Het
Csmd1	A	T	8: 16,202,055	L929Q	probably damaging	Het
Ctss	A	C	3: 95,546,809	H224P	possibly damaging	Het
Cyp4a12a	C	A	4: 115,328,718	H408N	probably benign	Het
Gm10549	C	T	18: 33,464,322	P54S	unknown	Het
Gpr162	T	C	6: 124,861,334	M118V	possibly damaging	Het
Ifnar1	C	T	16: 91,495,479	P207L	probably benign	Het
Igfn1	A	T	1: 135,972,087	C495*	probably null	Het
Jmjd4	T	A	11: 59,454,935	D280E	probably benign	Het
Krtap1-4	G	A	11: 99,583,343	Q96*	probably null	Het
Ksr2	T	A	5: 117,689,641	I495N	probably benign	Het
Lama2	T	A	10: 27,212,190	N864Y	probably damaging	Het
Lce1f	TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT	TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT	3: 92,718,965		probably benign	Het
Lig4	A	G	8: 9,972,538	V414A	possibly damaging	Het
Lman2l	A	G	1: 36,428,334	F211S	probably damaging	Het
Lmtk3	A	G	7: 45,793,888	E665G	probably damaging	Het
Mdm4	G	A	1: 133,011,099	L86F	probably damaging	Het
Mfsd10	C	A	5: 34,636,704	E22*	probably null	Het
Mindy1	C	T	3: 95,295,279	L394F	probably benign	Het
Mroh4	T	C	15: 74,610,911	M735V	probably benign	Het
Myo7a	T	A	7: 98,076,666	M1060L	probably benign	Het
Myo7b	C	A	18: 31,977,043	S1122I	probably damaging	Het
Nudt17	T	A	3: 96,706,372	R313S	probably damaging	Het
Olfr1097	T	A	2: 86,890,261	M305L	probably benign	Het
Olfr1138	T	A	2: 87,737,745	Q193L	probably benign	Het
Olfr669	A	G	7: 104,939,166	I213M	probably benign	Het
Olfr808	T	G	10: 129,768,166	I223M	possibly damaging	Het
Otogl	T	C	10: 107,782,029	Y1741C	probably damaging	Het
Pja2	A	G	17: 64,311,209	V65A	probably damaging	Het
Primpol	A	G	8: 46,590,283	V325A	probably benign	Het
Prss36	T	C	7: 127,946,525		probably benign	Het
Ptpn20	T	G	14: 33,630,908	Y201*	probably null	Het
Rundc3a	T	C	11: 102,402,064	S428P	probably damaging	Het
Rxra	T	A	2: 27,759,663	L460Q	probably damaging	Het
Sdsl	C	T	5: 120,459,883	V182M	probably damaging	Het
Slc14a2	A	C	18: 78,184,608	I226S	probably null	Het
Spam1	T	A	6: 24,800,566	C435S	probably damaging	Het
Stbd1	A	G	5: 92,605,418	T256A	possibly damaging	Het
Ttc39c	T	A	18: 12,720,045		probably null	Het
Uba3	T	C	6: 97,184,850	D440G	probably benign	Het
Ythdf1	A	C	2: 180,912,205	S72R	probably benign	Het
Zfp770	T	C	2: 114,196,436	E384G	possibly damaging	Het
Zfp979	G	T	4: 147,613,901	T117K	probably damaging	Het

Other mutations in Ints9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ints9	APN	14	65037421	missense	probably benign	0.00
IGL02374:Ints9	APN	14	65039333	missense	probably benign	0.00
IGL02728:Ints9	APN	14	64993008	missense	probably damaging	1.00
IGL02992:Ints9	APN	14	64980164	missense	probably benign	0.08
IGL03151:Ints9	APN	14	65032340	missense	possibly damaging	0.86
R0437:Ints9	UTSW	14	64986369	splice site	probably benign
R0582:Ints9	UTSW	14	64980149	missense	probably damaging	1.00
R1525:Ints9	UTSW	14	64995011	missense	probably benign	0.05
R1569:Ints9	UTSW	14	64980122	missense	possibly damaging	0.91
R1835:Ints9	UTSW	14	65032256	missense	probably damaging	1.00
R1839:Ints9	UTSW	14	65016530	missense	probably damaging	1.00
R1862:Ints9	UTSW	14	65026413	missense	probably benign
R1892:Ints9	UTSW	14	65020423	missense	probably benign	0.08
R2146:Ints9	UTSW	14	64986343	missense	possibly damaging	0.71
R2285:Ints9	UTSW	14	65007997	missense	possibly damaging	0.61
R3015:Ints9	UTSW	14	64950278	missense	probably benign	0.00
R4133:Ints9	UTSW	14	64990554	missense	probably benign
R4180:Ints9	UTSW	14	64992981	missense	probably damaging	1.00
R4509:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4510:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4511:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4608:Ints9	UTSW	14	65032280	missense	possibly damaging	0.82
R5023:Ints9	UTSW	14	64980228	missense	probably damaging	1.00
R5117:Ints9	UTSW	14	64993091	nonsense	probably null
R5261:Ints9	UTSW	14	65008072	missense	probably benign	0.25
R5582:Ints9	UTSW	14	65028896	missense	possibly damaging	0.83
R5990:Ints9	UTSW	14	65039328	missense	probably damaging	1.00
R6009:Ints9	UTSW	14	65008082	missense	probably benign	0.43
R6241:Ints9	UTSW	14	64980210	missense	possibly damaging	0.90
R6351:Ints9	UTSW	14	64993007	missense	probably damaging	0.98
R6821:Ints9	UTSW	14	65037458	missense	probably benign	0.20
R7422:Ints9	UTSW	14	65032298	missense	possibly damaging	0.93
R7442:Ints9	UTSW	14	64995064	nonsense	probably null
R7475:Ints9	UTSW	14	65026465	missense	probably null	0.23
R8183:Ints9	UTSW	14	65036453	missense	probably damaging	0.98
R8223:Ints9	UTSW	14	65020360	missense	possibly damaging	0.94
R8282:Ints9	UTSW	14	65007308	missense	probably benign	0.00
R8314:Ints9	UTSW	14	65029030	missense	probably damaging	1.00
R8341:Ints9	UTSW	14	65036414	missense	probably benign	0.14
R8548:Ints9	UTSW	14	65032321	missense	probably benign	0.39
R9434:Ints9	UTSW	14	65008057	missense	probably benign	0.00
Z1176:Ints9	UTSW	14	65037454	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGGCCATACTGTTTCCTTG -3'
(R):5'- GGCAGCATCCTACAGAACTG -3'

Sequencing Primer
(F):5'- GCGCATCCTTTCCTGACAAGG -3'
(R):5'- GCAGCATCCTACAGAACTGAAGAC -3'

Posted On

2022-04-18