Mutagenetix > Incidental Mutation

Incidental Mutation 'R9356:Slc14a2'

708440

Institutional Source

Beutler Lab

Gene Symbol

Slc14a2

Ensembl Gene

ENSMUSG00000024552

Gene Name

solute carrier family 14 (urea transporter), member 2

Synonyms

UT-A5, UT-A3

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9356 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78146940-78209094 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 78184608 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 226 (I226S)

Ref Sequence

ENSEMBL: ENSMUSP00000126416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000163367]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000025434
AA Change: I364S

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: I364S

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
Pfam:UT	128	423	1.9e-105	PFAM
low complexity region	460	471	N/A	INTRINSIC
Pfam:UT	591	886	7.5e-112	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000163367
AA Change: I226S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000126416
Gene: ENSMUSG00000024552
AA Change: I226S

Domain	Start	End	E-Value	Type
Pfam:UT	1	292	3.4e-113	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,289,323	K2618E	possibly damaging	Het
Abca13	G	A	11: 9,256,305	V202M	probably benign	Het
Ago3	A	T	4: 126,370,351	I354N	probably damaging	Het
Ankrd50	A	T	3: 38,456,087	D710E	probably damaging	Het
Apba2	A	T	7: 64,695,673	N204Y	probably damaging	Het
Arrdc4	A	G	7: 68,744,879	V139A	possibly damaging	Het
Baz1b	A	G	5: 135,210,799	E251G	probably benign	Het
Calcr	T	C	6: 3,687,408	D530G	probably benign	Het
Chrna7	A	T	7: 63,107,689	V154E	probably damaging	Het
Cldn15	T	C	5: 136,968,114	V3A	probably benign	Het
Csmd1	A	T	8: 16,202,055	L929Q	probably damaging	Het
Ctss	A	C	3: 95,546,809	H224P	possibly damaging	Het
Cyp4a12a	C	A	4: 115,328,718	H408N	probably benign	Het
Gm10549	C	T	18: 33,464,322	P54S	unknown	Het
Gpr162	T	C	6: 124,861,334	M118V	possibly damaging	Het
Ifnar1	C	T	16: 91,495,479	P207L	probably benign	Het
Igfn1	A	T	1: 135,972,087	C495*	probably null	Het
Ints9	T	C	14: 65,032,321	S487P	probably benign	Het
Jmjd4	T	A	11: 59,454,935	D280E	probably benign	Het
Krtap1-4	G	A	11: 99,583,343	Q96*	probably null	Het
Ksr2	T	A	5: 117,689,641	I495N	probably benign	Het
Lama2	T	A	10: 27,212,190	N864Y	probably damaging	Het
Lce1f	TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT	TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT	3: 92,718,965		probably benign	Het
Lig4	A	G	8: 9,972,538	V414A	possibly damaging	Het
Lman2l	A	G	1: 36,428,334	F211S	probably damaging	Het
Lmtk3	A	G	7: 45,793,888	E665G	probably damaging	Het
Mdm4	G	A	1: 133,011,099	L86F	probably damaging	Het
Mfsd10	C	A	5: 34,636,704	E22*	probably null	Het
Mindy1	C	T	3: 95,295,279	L394F	probably benign	Het
Mroh4	T	C	15: 74,610,911	M735V	probably benign	Het
Myo7a	T	A	7: 98,076,666	M1060L	probably benign	Het
Myo7b	C	A	18: 31,977,043	S1122I	probably damaging	Het
Nudt17	T	A	3: 96,706,372	R313S	probably damaging	Het
Olfr1097	T	A	2: 86,890,261	M305L	probably benign	Het
Olfr1138	T	A	2: 87,737,745	Q193L	probably benign	Het
Olfr669	A	G	7: 104,939,166	I213M	probably benign	Het
Olfr808	T	G	10: 129,768,166	I223M	possibly damaging	Het
Otogl	T	C	10: 107,782,029	Y1741C	probably damaging	Het
Pja2	A	G	17: 64,311,209	V65A	probably damaging	Het
Primpol	A	G	8: 46,590,283	V325A	probably benign	Het
Prss36	T	C	7: 127,946,525		probably benign	Het
Ptpn20	T	G	14: 33,630,908	Y201*	probably null	Het
Rundc3a	T	C	11: 102,402,064	S428P	probably damaging	Het
Rxra	T	A	2: 27,759,663	L460Q	probably damaging	Het
Sdsl	C	T	5: 120,459,883	V182M	probably damaging	Het
Spam1	T	A	6: 24,800,566	C435S	probably damaging	Het
Stbd1	A	G	5: 92,605,418	T256A	possibly damaging	Het
Ttc39c	T	A	18: 12,720,045		probably null	Het
Uba3	T	C	6: 97,184,850	D440G	probably benign	Het
Ythdf1	A	C	2: 180,912,205	S72R	probably benign	Het
Zfp770	T	C	2: 114,196,436	E384G	possibly damaging	Het
Zfp979	G	T	4: 147,613,901	T117K	probably damaging	Het

Other mutations in Slc14a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Slc14a2	APN	18	78150438	missense	possibly damaging	0.65
IGL00763:Slc14a2	APN	18	78192238	missense	probably damaging	1.00
IGL01359:Slc14a2	APN	18	78154108	missense	probably benign	0.01
IGL01400:Slc14a2	APN	18	78192213	missense	probably damaging	1.00
IGL01450:Slc14a2	APN	18	78183530	missense	probably damaging	0.97
IGL01469:Slc14a2	APN	18	78155566	missense	probably damaging	0.98
IGL02231:Slc14a2	APN	18	78209021	missense	possibly damaging	0.92
IGL02340:Slc14a2	APN	18	78163126	missense	probably damaging	1.00
IGL02542:Slc14a2	APN	18	78209087	missense	probably benign
xi_ning	UTSW	18	78195747	missense	probably benign	0.01
IGL02991:Slc14a2	UTSW	18	78205834	start codon destroyed	probably null	0.77
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0132:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0601:Slc14a2	UTSW	18	78157179	nonsense	probably null
R1677:Slc14a2	UTSW	18	78163204	missense	probably benign
R1749:Slc14a2	UTSW	18	78147080	missense	possibly damaging	0.67
R2014:Slc14a2	UTSW	18	78150386	splice site	probably benign
R2034:Slc14a2	UTSW	18	78183583	missense	probably damaging	0.99
R2264:Slc14a2	UTSW	18	78163089	splice site	probably benign
R2278:Slc14a2	UTSW	18	78159944	missense	probably benign	0.01
R2920:Slc14a2	UTSW	18	78158297	nonsense	probably null
R3878:Slc14a2	UTSW	18	78159074	missense	probably benign
R4086:Slc14a2	UTSW	18	78205783	missense	probably damaging	1.00
R4237:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4238:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4239:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4300:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4373:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4375:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4376:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4440:Slc14a2	UTSW	18	78195747	missense	probably benign	0.01
R4551:Slc14a2	UTSW	18	78195853	missense	probably benign	0.02
R4636:Slc14a2	UTSW	18	78195792	missense	possibly damaging	0.88
R4749:Slc14a2	UTSW	18	78155581	missense	probably damaging	1.00
R4921:Slc14a2	UTSW	18	78192188	missense	probably damaging	0.97
R4983:Slc14a2	UTSW	18	78150401	missense	probably damaging	0.98
R5114:Slc14a2	UTSW	18	78195748	missense	possibly damaging	0.62
R5164:Slc14a2	UTSW	18	78157272	missense	probably damaging	1.00
R5386:Slc14a2	UTSW	18	78185840	missense	possibly damaging	0.65
R5433:Slc14a2	UTSW	18	78208928	missense	probably damaging	1.00
R5558:Slc14a2	UTSW	18	78159166	missense	possibly damaging	0.94
R5571:Slc14a2	UTSW	18	78209067	missense	possibly damaging	0.73
R5693:Slc14a2	UTSW	18	78147014	missense	probably benign	0.23
R5715:Slc14a2	UTSW	18	78158336	missense	probably damaging	1.00
R5719:Slc14a2	UTSW	18	78209042	missense	probably benign	0.06
R6160:Slc14a2	UTSW	18	78158975	critical splice donor site	probably null
R6352:Slc14a2	UTSW	18	78209094	start codon destroyed	probably null
R6380:Slc14a2	UTSW	18	78146975	missense	probably benign	0.00
R6444:Slc14a2	UTSW	18	78154102	missense	probably damaging	0.98
R6480:Slc14a2	UTSW	18	78159082	missense	possibly damaging	0.80
R6732:Slc14a2	UTSW	18	78192174	missense	probably damaging	1.00
R7038:Slc14a2	UTSW	18	78159037	missense	probably damaging	0.98
R7553:Slc14a2	UTSW	18	78155588	missense	probably damaging	1.00
R7558:Slc14a2	UTSW	18	78192119	missense	probably benign	0.07
R7617:Slc14a2	UTSW	18	78159941	missense	probably benign
R7693:Slc14a2	UTSW	18	78154003	missense	possibly damaging	0.81
R7874:Slc14a2	UTSW	18	78160768	missense	probably benign	0.01
R8144:Slc14a2	UTSW	18	78184544	critical splice donor site	probably null
R9205:Slc14a2	UTSW	18	78195736	missense	probably benign	0.19
Z1088:Slc14a2	UTSW	18	78195780	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157368	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157369	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- ATTGGGTCAGGAGTCCTCAC -3'
(R):5'- TTGTGATATTTACAGAGGCCCC -3'

Sequencing Primer
(F):5'- GTCAGGAGTCCTCACTTTGAG -3'
(R):5'- AGGCCCCTCTGATAAGCAG -3'

Posted On

2022-04-18