Incidental Mutation 'R9356:Slc14a2'
ID 708440
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Name solute carrier family 14 (urea transporter), member 2
Synonyms UT-A5, UT-A3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9356 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 78146940-78209094 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 78184608 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 226 (I226S)
Ref Sequence ENSEMBL: ENSMUSP00000126416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000163367]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025434
AA Change: I364S

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: I364S

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163367
AA Change: I226S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126416
Gene: ENSMUSG00000024552
AA Change: I226S

DomainStartEndE-ValueType
Pfam:UT 1 292 3.4e-113 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,289,323 K2618E possibly damaging Het
Abca13 G A 11: 9,256,305 V202M probably benign Het
Ago3 A T 4: 126,370,351 I354N probably damaging Het
Ankrd50 A T 3: 38,456,087 D710E probably damaging Het
Apba2 A T 7: 64,695,673 N204Y probably damaging Het
Arrdc4 A G 7: 68,744,879 V139A possibly damaging Het
Baz1b A G 5: 135,210,799 E251G probably benign Het
Calcr T C 6: 3,687,408 D530G probably benign Het
Chrna7 A T 7: 63,107,689 V154E probably damaging Het
Cldn15 T C 5: 136,968,114 V3A probably benign Het
Csmd1 A T 8: 16,202,055 L929Q probably damaging Het
Ctss A C 3: 95,546,809 H224P possibly damaging Het
Cyp4a12a C A 4: 115,328,718 H408N probably benign Het
Gm10549 C T 18: 33,464,322 P54S unknown Het
Gpr162 T C 6: 124,861,334 M118V possibly damaging Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Igfn1 A T 1: 135,972,087 C495* probably null Het
Ints9 T C 14: 65,032,321 S487P probably benign Het
Jmjd4 T A 11: 59,454,935 D280E probably benign Het
Krtap1-4 G A 11: 99,583,343 Q96* probably null Het
Ksr2 T A 5: 117,689,641 I495N probably benign Het
Lama2 T A 10: 27,212,190 N864Y probably damaging Het
Lce1f TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT 3: 92,718,965 probably benign Het
Lig4 A G 8: 9,972,538 V414A possibly damaging Het
Lman2l A G 1: 36,428,334 F211S probably damaging Het
Lmtk3 A G 7: 45,793,888 E665G probably damaging Het
Mdm4 G A 1: 133,011,099 L86F probably damaging Het
Mfsd10 C A 5: 34,636,704 E22* probably null Het
Mindy1 C T 3: 95,295,279 L394F probably benign Het
Mroh4 T C 15: 74,610,911 M735V probably benign Het
Myo7a T A 7: 98,076,666 M1060L probably benign Het
Myo7b C A 18: 31,977,043 S1122I probably damaging Het
Nudt17 T A 3: 96,706,372 R313S probably damaging Het
Olfr1097 T A 2: 86,890,261 M305L probably benign Het
Olfr1138 T A 2: 87,737,745 Q193L probably benign Het
Olfr669 A G 7: 104,939,166 I213M probably benign Het
Olfr808 T G 10: 129,768,166 I223M possibly damaging Het
Otogl T C 10: 107,782,029 Y1741C probably damaging Het
Pja2 A G 17: 64,311,209 V65A probably damaging Het
Primpol A G 8: 46,590,283 V325A probably benign Het
Prss36 T C 7: 127,946,525 probably benign Het
Ptpn20 T G 14: 33,630,908 Y201* probably null Het
Rundc3a T C 11: 102,402,064 S428P probably damaging Het
Rxra T A 2: 27,759,663 L460Q probably damaging Het
Sdsl C T 5: 120,459,883 V182M probably damaging Het
Spam1 T A 6: 24,800,566 C435S probably damaging Het
Stbd1 A G 5: 92,605,418 T256A possibly damaging Het
Ttc39c T A 18: 12,720,045 probably null Het
Uba3 T C 6: 97,184,850 D440G probably benign Het
Ythdf1 A C 2: 180,912,205 S72R probably benign Het
Zfp770 T C 2: 114,196,436 E384G possibly damaging Het
Zfp979 G T 4: 147,613,901 T117K probably damaging Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78150438 missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78192238 missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78154108 missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78192213 missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78183530 missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78155566 missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78209021 missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78163126 missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78209087 missense probably benign
xi_ning UTSW 18 78195747 missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78205834 start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78157179 nonsense probably null
R1677:Slc14a2 UTSW 18 78163204 missense probably benign
R1749:Slc14a2 UTSW 18 78147080 missense possibly damaging 0.67
R2014:Slc14a2 UTSW 18 78150386 splice site probably benign
R2034:Slc14a2 UTSW 18 78183583 missense probably damaging 0.99
R2264:Slc14a2 UTSW 18 78163089 splice site probably benign
R2278:Slc14a2 UTSW 18 78159944 missense probably benign 0.01
R2920:Slc14a2 UTSW 18 78158297 nonsense probably null
R3878:Slc14a2 UTSW 18 78159074 missense probably benign
R4086:Slc14a2 UTSW 18 78205783 missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4375:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4376:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78195747 missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78195853 missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78195792 missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78155581 missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78192188 missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78150401 missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78195748 missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78157272 missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78185840 missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78208928 missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78159166 missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78209067 missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78147014 missense probably benign 0.23
R5715:Slc14a2 UTSW 18 78158336 missense probably damaging 1.00
R5719:Slc14a2 UTSW 18 78209042 missense probably benign 0.06
R6160:Slc14a2 UTSW 18 78158975 critical splice donor site probably null
R6352:Slc14a2 UTSW 18 78209094 start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78146975 missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78154102 missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78159082 missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78192174 missense probably damaging 1.00
R7038:Slc14a2 UTSW 18 78159037 missense probably damaging 0.98
R7553:Slc14a2 UTSW 18 78155588 missense probably damaging 1.00
R7558:Slc14a2 UTSW 18 78192119 missense probably benign 0.07
R7617:Slc14a2 UTSW 18 78159941 missense probably benign
R7693:Slc14a2 UTSW 18 78154003 missense possibly damaging 0.81
R7874:Slc14a2 UTSW 18 78160768 missense probably benign 0.01
R8144:Slc14a2 UTSW 18 78184544 critical splice donor site probably null
R9205:Slc14a2 UTSW 18 78195736 missense probably benign 0.19
Z1088:Slc14a2 UTSW 18 78195780 missense probably damaging 1.00
Z1176:Slc14a2 UTSW 18 78157368 missense probably damaging 1.00
Z1176:Slc14a2 UTSW 18 78157369 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ATTGGGTCAGGAGTCCTCAC -3'
(R):5'- TTGTGATATTTACAGAGGCCCC -3'

Sequencing Primer
(F):5'- GTCAGGAGTCCTCACTTTGAG -3'
(R):5'- AGGCCCCTCTGATAAGCAG -3'
Posted On 2022-04-18