Incidental Mutation 'R9357:Myh7b'
ID 708446
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Name myosin, heavy chain 7B, cardiac muscle, beta
Synonyms Myh14
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9357 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155611212-155634307 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155621348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 500 (E500G)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
AlphaFold A2AQP0
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: E500G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: E500G

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,870 V900A probably benign Het
Adam28 C T 14: 68,642,030 A190T probably benign Het
Ager T C 17: 34,598,567 V116A probably damaging Het
Agt G T 8: 124,564,326 H81N probably benign Het
Apc2 T C 10: 80,311,038 V642A probably damaging Het
Atg4b C T 1: 93,785,926 T325M probably damaging Het
Atp10b A G 11: 43,259,884 S1470G probably benign Het
Cacul1 A G 19: 60,545,504 I220T probably benign Het
Ccdc7a T C 8: 128,944,655 probably null Het
Cnnm1 A C 19: 43,441,388 D315A probably damaging Het
Fam46a A T 9: 85,326,619 N50K probably benign Het
Fbxo24 A G 5: 137,612,834 F565L probably damaging Het
Fpr-rs4 T A 17: 18,021,949 S73T probably damaging Het
Gbp7 T C 3: 142,543,128 V384A probably benign Het
Gcnt2 A T 13: 40,888,256 H297L possibly damaging Het
Glo1 T C 17: 30,612,544 E3G probably benign Het
Gsdmc4 T C 15: 63,900,347 D161G probably benign Het
Ifi213 T A 1: 173,568,826 M561L probably benign Het
Ighv1-63 A G 12: 115,495,858 S40P probably damaging Het
Itpr2 A G 6: 146,359,316 L971P probably damaging Het
Lrp2 A T 2: 69,506,573 I1285N probably damaging Het
Map1b A T 13: 99,430,200 Y2004* probably null Het
Mindy1 C T 3: 95,295,279 L394F probably benign Het
Mug1 A G 6: 121,875,491 D846G probably benign Het
Myo18a C T 11: 77,842,188 T1348M probably damaging Het
Myo7b A T 18: 31,960,076 I2027N probably damaging Het
Neb T C 2: 52,179,568 probably null Het
Obscn G A 11: 59,038,766 R5208C probably damaging Het
Parg G A 14: 32,274,917 D827N probably damaging Het
Pcdha6 A T 18: 36,969,173 H473L probably benign Het
Pde4dip A G 3: 97,718,329 S1318P probably benign Het
Ppan T C 9: 20,889,924 S166P possibly damaging Het
Ppargc1b C A 18: 61,315,868 A128S probably damaging Het
Rdh16f2 T A 10: 127,877,046 D304E possibly damaging Het
Sh3pxd2a A T 19: 47,272,009 L435Q probably damaging Het
Slc35d1 A T 4: 103,208,136 Y183N Het
Sspo T C 6: 48,467,055 S2166P possibly damaging Het
Twf2 T C 9: 106,214,901 F319S probably benign Het
Ush2a C T 1: 188,874,950 T4014M probably benign Het
Vmn1r3 T G 4: 3,185,149 T53P probably damaging Het
Vmn2r76 T C 7: 86,231,220 E86G probably benign Het
Wdtc1 A G 4: 133,296,471 Y530H probably damaging Het
Xdh A G 17: 73,907,716 F745L probably damaging Het
Xdh A C 17: 73,926,546 probably null Het
Zfp358 T C 8: 3,495,568 L50P probably damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
Muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7678:Myh7b UTSW 2 155617778 splice site probably null
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
R7711:Myh7b UTSW 2 155620403 missense probably damaging 1.00
R7923:Myh7b UTSW 2 155625966 missense probably benign
R7967:Myh7b UTSW 2 155614199 splice site probably null
R8045:Myh7b UTSW 2 155613181 missense probably benign 0.00
R8176:Myh7b UTSW 2 155625966 missense probably benign 0.06
R8272:Myh7b UTSW 2 155632904 missense probably damaging 1.00
R8560:Myh7b UTSW 2 155623204 missense possibly damaging 0.93
R8706:Myh7b UTSW 2 155611749 critical splice donor site probably null
R8824:Myh7b UTSW 2 155630381 missense probably benign 0.02
R8832:Myh7b UTSW 2 155633262 missense probably benign 0.00
R9079:Myh7b UTSW 2 155623254 missense probably damaging 0.97
R9151:Myh7b UTSW 2 155632519 missense probably damaging 1.00
R9311:Myh7b UTSW 2 155621333 missense probably damaging 1.00
R9332:Myh7b UTSW 2 155628802 missense probably damaging 1.00
R9388:Myh7b UTSW 2 155631063 missense probably benign 0.28
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTATCGGGGTCCTGGACATCG -3'
(R):5'- ACCACACATTGATAGGCAGC -3'

Sequencing Primer
(F):5'- TCTCAACCACGGCAGAGG -3'
(R):5'- CATTGATAGGCAGCTTATCCAGGC -3'
Posted On 2022-04-18