Incidental Mutation 'R9357:Xdh'
ID 708480
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms xanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R9357 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 73883908-73950182 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 73926546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably null
Transcript: ENSMUST00000024866
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,870 V900A probably benign Het
Adam28 C T 14: 68,642,030 A190T probably benign Het
Ager T C 17: 34,598,567 V116A probably damaging Het
Agt G T 8: 124,564,326 H81N probably benign Het
Apc2 T C 10: 80,311,038 V642A probably damaging Het
Atg4b C T 1: 93,785,926 T325M probably damaging Het
Atp10b A G 11: 43,259,884 S1470G probably benign Het
Cacul1 A G 19: 60,545,504 I220T probably benign Het
Ccdc7a T C 8: 128,944,655 probably null Het
Cnnm1 A C 19: 43,441,388 D315A probably damaging Het
Fam46a A T 9: 85,326,619 N50K probably benign Het
Fbxo24 A G 5: 137,612,834 F565L probably damaging Het
Fpr-rs4 T A 17: 18,021,949 S73T probably damaging Het
Gbp7 T C 3: 142,543,128 V384A probably benign Het
Gcnt2 A T 13: 40,888,256 H297L possibly damaging Het
Glo1 T C 17: 30,612,544 E3G probably benign Het
Gsdmc4 T C 15: 63,900,347 D161G probably benign Het
Ifi213 T A 1: 173,568,826 M561L probably benign Het
Ighv1-63 A G 12: 115,495,858 S40P probably damaging Het
Itpr2 A G 6: 146,359,316 L971P probably damaging Het
Lrp2 A T 2: 69,506,573 I1285N probably damaging Het
Map1b A T 13: 99,430,200 Y2004* probably null Het
Mindy1 C T 3: 95,295,279 L394F probably benign Het
Mug1 A G 6: 121,875,491 D846G probably benign Het
Myh7b A G 2: 155,621,348 E500G probably damaging Het
Myo18a C T 11: 77,842,188 T1348M probably damaging Het
Myo7b A T 18: 31,960,076 I2027N probably damaging Het
Neb T C 2: 52,179,568 probably null Het
Obscn G A 11: 59,038,766 R5208C probably damaging Het
Parg G A 14: 32,274,917 D827N probably damaging Het
Pcdha6 A T 18: 36,969,173 H473L probably benign Het
Pde4dip A G 3: 97,718,329 S1318P probably benign Het
Ppan T C 9: 20,889,924 S166P possibly damaging Het
Ppargc1b C A 18: 61,315,868 A128S probably damaging Het
Rdh16f2 T A 10: 127,877,046 D304E possibly damaging Het
Sh3pxd2a A T 19: 47,272,009 L435Q probably damaging Het
Slc35d1 A T 4: 103,208,136 Y183N Het
Sspo T C 6: 48,467,055 S2166P possibly damaging Het
Twf2 T C 9: 106,214,901 F319S probably benign Het
Ush2a C T 1: 188,874,950 T4014M probably benign Het
Vmn1r3 T G 4: 3,185,149 T53P probably damaging Het
Vmn2r76 T C 7: 86,231,220 E86G probably benign Het
Wdtc1 A G 4: 133,296,471 Y530H probably damaging Het
Zfp358 T C 8: 3,495,568 L50P probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
inky UTSW 17 73921351 missense probably damaging 1.00
nucleus UTSW 17 73899012 nonsense probably null
squidgame UTSW 17 73939836 missense probably benign
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8680:Xdh UTSW 17 73922505 missense probably benign
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
R9149:Xdh UTSW 17 73915693 missense probably benign
R9181:Xdh UTSW 17 73925011 missense probably damaging 1.00
R9357:Xdh UTSW 17 73907716 missense probably damaging 0.97
R9609:Xdh UTSW 17 73924995 missense possibly damaging 0.91
R9803:Xdh UTSW 17 73922460 missense probably benign
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGTCCTGGGAGAAGAAACG -3'
(R):5'- GCAGTGCTTCTCCCATTGATG -3'

Sequencing Primer
(F):5'- AGAAACGAGGCTTCTCTGC -3'
(R):5'- TCCCATTGATGCAGGCTG -3'
Posted On 2022-04-18