Incidental Mutation 'R9358:Tln1'
ID 708506
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9358 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43531513-43562583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 43532084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 2501 (I2501S)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000030187
AA Change: I2501S

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: I2501S

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A T 3: 121,474,976 (GRCm39) K149* probably null Het
Ap3m2 G A 8: 23,280,959 (GRCm39) S365F possibly damaging Het
Apob T A 12: 8,060,833 (GRCm39) I3105K probably benign Het
Arfgef3 A G 10: 18,492,628 (GRCm39) L1261P probably damaging Het
Armc8 A G 9: 99,450,653 (GRCm39) probably null Het
Axin2 A G 11: 108,814,873 (GRCm39) T254A probably benign Het
Cachd1 G A 4: 100,833,622 (GRCm39) V800M probably damaging Het
Camta1 A G 4: 151,222,881 (GRCm39) L892P probably damaging Het
Cfap58 C T 19: 47,962,987 (GRCm39) R466* probably null Het
Cilp A G 9: 65,183,269 (GRCm39) Q391R probably benign Het
Cracd A T 5: 77,002,836 (GRCm39) I137F probably damaging Het
Ctcfl T A 2: 172,960,581 (GRCm39) M1L possibly damaging Het
Dnah14 G A 1: 181,536,598 (GRCm39) A2414T probably benign Het
Dnah2 A G 11: 69,406,592 (GRCm39) L550P probably damaging Het
Erich6b T A 14: 75,902,668 (GRCm39) S162T probably benign Het
Fbxw7 C A 3: 84,883,561 (GRCm39) H578Q Het
Fer T C 17: 64,280,076 (GRCm39) L418P possibly damaging Het
Fndc3b A C 3: 27,505,556 (GRCm39) L904R possibly damaging Het
Gabrg1 A T 5: 70,935,422 (GRCm39) I249N possibly damaging Het
Gbe1 T A 16: 70,238,127 (GRCm39) D304E probably benign Het
Gm10549 C T 18: 33,597,375 (GRCm39) P54S unknown Het
Gpatch4 G T 3: 87,962,452 (GRCm39) E222* probably null Het
Heatr1 A T 13: 12,433,087 (GRCm39) T1146S probably benign Het
Hrc A C 7: 44,985,984 (GRCm39) E378D probably benign Het
Hspg2 G T 4: 137,244,909 (GRCm39) R878L probably damaging Het
Igkv1-122 A G 6: 67,993,756 (GRCm39) M11V probably benign Het
Itih3 T A 14: 30,643,885 (GRCm39) K75* probably null Het
Jag1 A G 2: 136,924,948 (GRCm39) V1218A probably benign Het
Kif28 C T 1: 179,563,695 (GRCm39) D94N probably benign Het
Lama2 G A 10: 27,064,378 (GRCm39) T1201M possibly damaging Het
Lama2 A G 10: 27,492,761 (GRCm39) L11P unknown Het
Lrfn2 T C 17: 49,403,530 (GRCm39) V551A probably damaging Het
Lrrc8d A G 5: 105,960,358 (GRCm39) N256S probably benign Het
Mindy1 C T 3: 95,202,590 (GRCm39) L394F probably benign Het
Mon2 A G 10: 122,868,452 (GRCm39) S534P probably benign Het
Mrps5 T A 2: 127,437,734 (GRCm39) I187N probably benign Het
Mto1 A G 9: 78,364,840 (GRCm39) M360V probably benign Het
Muc16 T G 9: 18,553,520 (GRCm39) I4258L probably benign Het
Myo10 A G 15: 25,781,520 (GRCm39) D1005G possibly damaging Het
Myo18b T A 5: 112,943,269 (GRCm39) R1645S possibly damaging Het
Naip2 A T 13: 100,298,080 (GRCm39) V652D probably damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Ncapd2 A T 6: 125,163,106 (GRCm39) M134K probably benign Het
Nup107 A G 10: 117,586,868 (GRCm39) F893S probably damaging Het
Or10j3 A T 1: 173,031,741 (GRCm39) R273W probably damaging Het
Or11h23 A G 14: 50,947,802 (GRCm39) E5G probably benign Het
Or1e35 A T 11: 73,797,451 (GRCm39) I289N probably damaging Het
Or4f14b A G 2: 111,775,429 (GRCm39) V124A probably benign Het
Or5p64 C T 7: 107,854,799 (GRCm39) C182Y probably damaging Het
Pcgf1 G T 6: 83,056,433 (GRCm39) R124L probably benign Het
Pdcd10 A T 3: 75,448,533 (GRCm39) N10K probably damaging Het
Pdx1 C T 5: 147,207,064 (GRCm39) Q6* probably null Het
Plcl1 T C 1: 55,735,810 (GRCm39) S384P probably damaging Het
Serpina1b T A 12: 103,694,653 (GRCm39) T364S possibly damaging Het
Slc5a11 C T 7: 122,857,775 (GRCm39) T288I probably damaging Het
Slc6a1 A T 6: 114,291,271 (GRCm39) S515C probably damaging Het
Snca A T 6: 60,710,121 (GRCm39) D119E probably benign Het
Sorcs2 T C 5: 36,200,814 (GRCm39) D578G probably damaging Het
Sulf1 T A 1: 12,890,729 (GRCm39) L389Q probably damaging Het
Thoc2l T C 5: 104,667,826 (GRCm39) F783L possibly damaging Het
Tmem191 A G 16: 17,094,257 (GRCm39) E27G probably damaging Het
Tmem200a G T 10: 25,869,677 (GRCm39) N197K probably benign Het
Tmem207 A T 16: 26,345,434 (GRCm39) S11T probably benign Het
Ttn T C 2: 76,564,953 (GRCm39) T28425A probably damaging Het
Ush2a C T 1: 188,607,147 (GRCm39) T4014M probably benign Het
Vac14 G A 8: 111,439,379 (GRCm39) probably null Het
Vmn2r32 A T 7: 7,477,197 (GRCm39) I398K probably damaging Het
Vmn2r77 A T 7: 86,452,236 (GRCm39) H472L probably benign Het
Vps45 C T 3: 95,940,976 (GRCm39) probably null Het
Wdr26 T C 1: 181,019,423 (GRCm39) H334R probably damaging Het
Zfp268 A T 4: 145,349,613 (GRCm39) Y350F possibly damaging Het
Zmynd10 A G 9: 107,426,249 (GRCm39) D132G possibly damaging Het
Zpbp2 A G 11: 98,444,774 (GRCm39) T123A probably benign Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43,542,719 (GRCm39) missense probably benign 0.22
IGL00987:Tln1 APN 4 43,551,297 (GRCm39) unclassified probably benign
IGL01345:Tln1 APN 4 43,536,281 (GRCm39) missense probably damaging 1.00
IGL01456:Tln1 APN 4 43,543,432 (GRCm39) unclassified probably benign
IGL01715:Tln1 APN 4 43,555,890 (GRCm39) missense probably damaging 1.00
IGL01750:Tln1 APN 4 43,545,435 (GRCm39) missense probably damaging 1.00
IGL01933:Tln1 APN 4 43,555,894 (GRCm39) missense possibly damaging 0.52
IGL01933:Tln1 APN 4 43,539,508 (GRCm39) missense probably benign
IGL02119:Tln1 APN 4 43,546,760 (GRCm39) missense probably damaging 0.99
IGL02148:Tln1 APN 4 43,555,388 (GRCm39) missense probably damaging 1.00
IGL02153:Tln1 APN 4 43,546,857 (GRCm39) missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43,540,612 (GRCm39) missense probably benign 0.07
IGL02691:Tln1 APN 4 43,539,544 (GRCm39) missense probably benign 0.42
IGL02882:Tln1 APN 4 43,539,522 (GRCm39) missense probably benign 0.45
IGL02892:Tln1 APN 4 43,555,679 (GRCm39) missense probably damaging 1.00
IGL03061:Tln1 APN 4 43,545,694 (GRCm39) missense probably damaging 1.00
IGL03102:Tln1 APN 4 43,532,861 (GRCm39) missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43,539,084 (GRCm39) splice site probably benign
H8786:Tln1 UTSW 4 43,544,589 (GRCm39) missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43,539,998 (GRCm39) missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43,542,701 (GRCm39) critical splice donor site probably null
R0206:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0208:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0454:Tln1 UTSW 4 43,553,504 (GRCm39) missense probably benign
R0539:Tln1 UTSW 4 43,543,434 (GRCm39) critical splice donor site probably null
R0548:Tln1 UTSW 4 43,542,709 (GRCm39) missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43,550,304 (GRCm39) missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43,547,756 (GRCm39) missense probably benign 0.34
R0607:Tln1 UTSW 4 43,553,071 (GRCm39) missense probably damaging 1.00
R0609:Tln1 UTSW 4 43,544,645 (GRCm39) missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43,555,333 (GRCm39) missense probably damaging 1.00
R0993:Tln1 UTSW 4 43,549,825 (GRCm39) missense probably benign 0.22
R1255:Tln1 UTSW 4 43,538,044 (GRCm39) missense probably damaging 1.00
R1292:Tln1 UTSW 4 43,534,578 (GRCm39) critical splice donor site probably null
R1752:Tln1 UTSW 4 43,536,311 (GRCm39) missense probably damaging 1.00
R2169:Tln1 UTSW 4 43,548,005 (GRCm39) missense probably damaging 1.00
R2172:Tln1 UTSW 4 43,545,721 (GRCm39) missense probably benign
R2202:Tln1 UTSW 4 43,553,083 (GRCm39) splice site probably null
R2680:Tln1 UTSW 4 43,539,668 (GRCm39) missense probably damaging 1.00
R3012:Tln1 UTSW 4 43,542,525 (GRCm39) missense probably benign
R3714:Tln1 UTSW 4 43,540,597 (GRCm39) missense probably damaging 1.00
R3735:Tln1 UTSW 4 43,549,370 (GRCm39) missense probably damaging 0.97
R3794:Tln1 UTSW 4 43,536,295 (GRCm39) missense probably damaging 1.00
R3825:Tln1 UTSW 4 43,536,413 (GRCm39) splice site probably benign
R3983:Tln1 UTSW 4 43,553,030 (GRCm39) missense probably damaging 1.00
R4061:Tln1 UTSW 4 43,549,177 (GRCm39) missense probably damaging 1.00
R4249:Tln1 UTSW 4 43,536,104 (GRCm39) missense probably damaging 1.00
R4287:Tln1 UTSW 4 43,543,509 (GRCm39) missense probably benign 0.01
R4471:Tln1 UTSW 4 43,551,018 (GRCm39) missense probably benign 0.03
R4562:Tln1 UTSW 4 43,533,598 (GRCm39) missense probably damaging 1.00
R4654:Tln1 UTSW 4 43,535,954 (GRCm39) missense probably null 1.00
R4737:Tln1 UTSW 4 43,540,588 (GRCm39) missense probably benign 0.00
R4936:Tln1 UTSW 4 43,547,522 (GRCm39) missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43,539,406 (GRCm39) missense probably benign 0.06
R5288:Tln1 UTSW 4 43,540,661 (GRCm39) missense probably benign 0.06
R5421:Tln1 UTSW 4 43,533,609 (GRCm39) missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43,543,905 (GRCm39) missense probably benign 0.26
R5660:Tln1 UTSW 4 43,547,732 (GRCm39) missense probably damaging 1.00
R5772:Tln1 UTSW 4 43,545,191 (GRCm39) missense probably benign 0.13
R6012:Tln1 UTSW 4 43,539,508 (GRCm39) missense probably benign
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6052:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6145:Tln1 UTSW 4 43,538,030 (GRCm39) missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43,534,744 (GRCm39) missense probably benign 0.06
R6242:Tln1 UTSW 4 43,533,145 (GRCm39) missense probably damaging 1.00
R6454:Tln1 UTSW 4 43,533,866 (GRCm39) missense probably damaging 0.99
R6467:Tln1 UTSW 4 43,543,165 (GRCm39) missense probably benign 0.42
R6548:Tln1 UTSW 4 43,547,525 (GRCm39) missense probably damaging 0.98
R6576:Tln1 UTSW 4 43,555,419 (GRCm39) splice site probably null
R6722:Tln1 UTSW 4 43,547,618 (GRCm39) missense probably damaging 1.00
R6968:Tln1 UTSW 4 43,550,217 (GRCm39) missense probably benign 0.02
R7000:Tln1 UTSW 4 43,556,302 (GRCm39) missense probably damaging 0.96
R7137:Tln1 UTSW 4 43,540,616 (GRCm39) missense probably damaging 1.00
R7242:Tln1 UTSW 4 43,542,602 (GRCm39) missense probably benign 0.01
R7294:Tln1 UTSW 4 43,534,399 (GRCm39) missense probably benign 0.02
R7312:Tln1 UTSW 4 43,545,922 (GRCm39) missense probably damaging 1.00
R7547:Tln1 UTSW 4 43,545,206 (GRCm39) missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43,554,309 (GRCm39) missense probably benign 0.01
R7874:Tln1 UTSW 4 43,555,606 (GRCm39) missense probably damaging 1.00
R7874:Tln1 UTSW 4 43,538,041 (GRCm39) missense probably damaging 1.00
R8030:Tln1 UTSW 4 43,535,737 (GRCm39) critical splice donor site probably null
R8105:Tln1 UTSW 4 43,538,231 (GRCm39) missense probably benign 0.32
R8212:Tln1 UTSW 4 43,555,918 (GRCm39) missense probably damaging 1.00
R8416:Tln1 UTSW 4 43,540,116 (GRCm39) missense probably benign 0.01
R8419:Tln1 UTSW 4 43,536,397 (GRCm39) missense probably damaging 1.00
R8680:Tln1 UTSW 4 43,553,041 (GRCm39) missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43,534,769 (GRCm39) splice site probably benign
R8725:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43,556,383 (GRCm39) missense probably benign
R8865:Tln1 UTSW 4 43,538,281 (GRCm39) missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9050:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9145:Tln1 UTSW 4 43,536,024 (GRCm39) missense probably damaging 1.00
R9210:Tln1 UTSW 4 43,536,119 (GRCm39) missense probably damaging 1.00
R9337:Tln1 UTSW 4 43,532,927 (GRCm39) missense probably damaging 1.00
R9346:Tln1 UTSW 4 43,546,895 (GRCm39) missense probably damaging 0.97
R9487:Tln1 UTSW 4 43,542,893 (GRCm39) missense probably damaging 1.00
R9631:Tln1 UTSW 4 43,545,694 (GRCm39) missense probably damaging 1.00
R9650:Tln1 UTSW 4 43,545,912 (GRCm39) missense probably damaging 1.00
R9666:Tln1 UTSW 4 43,542,957 (GRCm39) missense probably damaging 0.96
RF021:Tln1 UTSW 4 43,555,890 (GRCm39) missense probably damaging 1.00
X0052:Tln1 UTSW 4 43,533,125 (GRCm39) critical splice donor site probably null
X0063:Tln1 UTSW 4 43,548,015 (GRCm39) nonsense probably null
Z1176:Tln1 UTSW 4 43,543,211 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTTGGTAGTGGCAGGCACAG -3'
(R):5'- AAGAGGGCCTCAGATAACCTG -3'

Sequencing Primer
(F):5'- TAGTGGCAGGCACAGTCTCTG -3'
(R):5'- AAGCTGCAGCCTTCGAAG -3'
Posted On 2022-04-18