Mutagenetix > Incidental Mutations

Incidental Mutation 'R0744:Cd209e'

70852

Institutional Source

Beutler Lab

Gene Symbol

Cd209e

Ensembl Gene

ENSMUSG00000040197

Gene Name

CD209e antigen

Synonyms

mSIGNR4, SIGNR4

MMRRC Submission

038925-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.050) question?

Stock #

R0744 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3847965-3854309 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 3853205 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 62 (D62E)

Ref Sequence

ENSEMBL: ENSMUSP00000033888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033888]

AlphaFold

Q91ZW7

Predicted Effect

probably benign
Transcript: ENSMUST00000033888
AA Change: D62E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: D62E

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
CLECT	77	198	4.01e-33	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

98% (91/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,165,069	L41P	probably damaging	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aebp2	T	G	6: 140,642,364		probably null	Het
AI987944	T	C	7: 41,376,859	Y6C	probably damaging	Het
Ascc3	T	C	10: 50,845,666	W2072R	probably benign	Het
Asxl3	A	G	18: 22,516,040	D362G	probably damaging	Het
Baiap2l1	T	A	5: 144,266,641	D479V	probably benign	Het
Bdp1	A	T	13: 100,035,825	H2094Q	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd226	A	C	18: 89,207,020		probably benign	Het
Clip1	T	C	5: 123,630,721	D605G	probably benign	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dzip3	A	G	16: 48,959,675	Y301H	probably damaging	Het
Ephb4	T	A	5: 137,365,667	N600K	probably damaging	Het
Erich6	T	A	3: 58,636,122		probably benign	Het
Fbn1	T	C	2: 125,314,814		probably benign	Het
Fryl	A	T	5: 73,089,081		probably benign	Het
Galnt17	T	A	5: 131,150,916	D131V	probably damaging	Het
Gm13089	A	T	4: 143,698,486	M129K	probably benign	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Gm6619	T	A	6: 131,490,334	L54Q	probably damaging	Het
Herc2	T	C	7: 56,206,036		probably benign	Het
Hic1	T	A	11: 75,165,801	Q754L	possibly damaging	Het
Hnf4g	A	T	3: 3,651,629	D286V	possibly damaging	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itih1	A	T	14: 30,941,555	V164E	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Lrfn5	A	C	12: 61,839,668	T81P	probably damaging	Het
Lrrc58	A	G	16: 37,878,573		probably benign	Het
March6	T	C	15: 31,480,291	Y562C	probably benign	Het
Mark1	T	A	1: 184,921,608	I166F	probably damaging	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mast4	C	G	13: 102,737,387	Q1632H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mgst3	A	G	1: 167,373,805	Y104H	probably damaging	Het
Mlxipl	C	T	5: 135,132,475	T416I	possibly damaging	Het
Mthfd2l	T	C	5: 90,946,942	V90A	probably damaging	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Muc1	C	A	3: 89,230,328	P159Q	possibly damaging	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Myt1	TGAGGAGGAGGAGGAGGAGG	TGAGGAGGAGGAGGAGG	2: 181,797,505		probably benign	Het
Olfr1513	T	C	14: 52,349,378	I223V	probably benign	Het
Olfr329-ps	T	A	11: 58,543,162	M105L	possibly damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Pdcd6	A	G	13: 74,316,324		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Pzp	A	G	6: 128,516,195		probably benign	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapgef3	G	A	15: 97,761,585		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rgs11	T	A	17: 26,203,318	M29K	probably damaging	Het
Rictor	A	G	15: 6,764,278		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Samd9l	T	C	6: 3,372,725	E1512G	possibly damaging	Het
Sgsm1	C	T	5: 113,279,184	A127T	probably benign	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc26a1	T	A	5: 108,673,523	T167S	probably benign	Het
Slc2a12	T	C	10: 22,702,016		probably benign	Het
Slc44a5	T	C	3: 154,265,474	S654P	probably damaging	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Slc6a13	T	G	6: 121,302,867	W67G	probably damaging	Het
Sowahc	GGGAGGAGGAGGAGGAGGAGGAGGAGGA	GGGAGGAGGAGGAGGAGGAGGAGGA	10: 59,223,491		probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Supt20	T	A	3: 54,714,701	Y409N	probably damaging	Het
Synrg	C	T	11: 84,024,305	Q1046*	probably null	Het
Tab2	T	C	10: 7,907,581		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm6	T	C	2: 130,151,761	V640A	probably benign	Het
Tle2	T	C	10: 81,588,947	F667L	probably damaging	Het
Tnfaip3	C	A	10: 19,002,949	A704S	probably benign	Het
Tomm34	T	C	2: 164,070,976	N22D	probably benign	Het
Trabd2b	A	G	4: 114,580,322	Q232R	probably benign	Het
Trim62	A	G	4: 128,884,215	S16G	probably damaging	Het
Ttc28	T	A	5: 111,231,081	I1144N	probably damaging	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Ush2a	C	T	1: 188,814,406		probably benign	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zbed5	T	A	5: 129,902,272	V354E	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Cd209e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Cd209e	APN	8	3852800	missense	probably benign	0.05
IGL00920:Cd209e	APN	8	3849187	missense	probably damaging	1.00
IGL01132:Cd209e	APN	8	3851274	missense	probably benign	0.18
IGL02499:Cd209e	APN	8	3854238	missense	probably benign
R0124:Cd209e	UTSW	8	3851274	missense	probably benign	0.08
R0268:Cd209e	UTSW	8	3849125	missense	probably benign	0.34
R0540:Cd209e	UTSW	8	3851265	missense	probably benign	0.04
R0836:Cd209e	UTSW	8	3853205	missense	probably benign	0.00
R1241:Cd209e	UTSW	8	3849124	missense	probably damaging	0.99
R1367:Cd209e	UTSW	8	3849084	makesense	probably null
R2040:Cd209e	UTSW	8	3849158	missense	probably damaging	1.00
R2136:Cd209e	UTSW	8	3853248	missense	probably benign	0.00
R4787:Cd209e	UTSW	8	3851181	missense	probably null	0.69
R6283:Cd209e	UTSW	8	3849212	nonsense	probably null
R6338:Cd209e	UTSW	8	3849154	missense	probably damaging	1.00
R6894:Cd209e	UTSW	8	3853569	missense	possibly damaging	0.48
R8899:Cd209e	UTSW	8	3851212	nonsense	probably null
Z1176:Cd209e	UTSW	8	3849196	missense	probably benign	0.30
Z1177:Cd209e	UTSW	8	3851181	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- TTCTCCAGTCCAAGAGAGCCAAGG -3'
(R):5'- ACAACGGGTCTTTCAGCAGCAG -3'

Sequencing Primer
(F):5'- GATATCTCGACCCACTTTCTCCAC -3'
(R):5'- TAGCAGCTTCGTGGAACC -3'

Posted On

2013-09-30