Mutagenetix > Incidental Mutation

Incidental Mutation 'R9358:Heatr1'

708547

Institutional Source

Beutler Lab

Gene Symbol

Heatr1

Ensembl Gene

ENSMUSG00000050244

Gene Name

HEAT repeat containing 1

Synonyms

B130016L12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R9358 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12395027-12440289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12418206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1146 (T1146S)

Ref Sequence

ENSEMBL: ENSMUSP00000054084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059270]

AlphaFold

G3X9B1

Predicted Effect

probably benign
Transcript: ENSMUST00000059270
AA Change: T1146S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: T1146S

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
Pfam:U3snoRNP10	238	354	7e-30	PFAM
SCOP:d1qbkb_	919	1795	3e-8	SMART
low complexity region	1805	1814	N/A	INTRINSIC
BP28CT	1856	2009	2.25e-77	SMART
Blast:BP28CT	2015	2061	2e-15	BLAST
coiled coil region	2109	2137	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432M17Rik	A	T	3: 121,681,327	K149*	probably null	Het
Ap3m2	G	A	8: 22,790,943	S365F	possibly damaging	Het
Apob	T	A	12: 8,010,833	I3105K	probably benign	Het
Arfgef3	A	G	10: 18,616,880	L1261P	probably damaging	Het
Armc8	A	G	9: 99,568,600		probably null	Het
Axin2	A	G	11: 108,924,047	T254A	probably benign	Het
BC005561	T	C	5: 104,519,960	F783L	possibly damaging	Het
C530008M17Rik	A	T	5: 76,854,989	I137F	probably damaging	Het
Cachd1	G	A	4: 100,976,425	V800M	probably damaging	Het
Camta1	A	G	4: 151,138,424	L892P	probably damaging	Het
Cfap58	C	T	19: 47,974,548	R466*	probably null	Het
Cilp	A	G	9: 65,275,987	Q391R	probably benign	Het
Ctcfl	T	A	2: 173,118,788	M1L	possibly damaging	Het
Dnah14	G	A	1: 181,709,033	A2414T	probably benign	Het
Dnah2	A	G	11: 69,515,766	L550P	probably damaging	Het
Erich6b	T	A	14: 75,665,228	S162T	probably benign	Het
Fbxw7	C	A	3: 84,976,254	H578Q		Het
Fer	T	C	17: 63,973,081	L418P	possibly damaging	Het
Fndc3b	A	C	3: 27,451,407	L904R	possibly damaging	Het
Gabrg1	A	T	5: 70,778,079	I249N	possibly damaging	Het
Gbe1	T	A	16: 70,441,239	D304E	probably benign	Het
Gm10549	C	T	18: 33,464,322	P54S	unknown	Het
Gm13212	A	T	4: 145,623,043	Y350F	possibly damaging	Het
Gpatch4	G	T	3: 88,055,145	E222*	probably null	Het
Hrc	A	C	7: 45,336,560	E378D	probably benign	Het
Hspg2	G	T	4: 137,517,598	R878L	probably damaging	Het
Igkv1-122	A	G	6: 68,016,772	M11V	probably benign	Het
Itih3	T	A	14: 30,921,928	K75*	probably null	Het
Jag1	A	G	2: 137,083,028	V1218A	probably benign	Het
Kif28	C	T	1: 179,736,130	D94N	probably benign	Het
Lama2	G	A	10: 27,188,382	T1201M	possibly damaging	Het
Lama2	A	G	10: 27,616,765	L11P	unknown	Het
Lrfn2	T	C	17: 49,096,502	V551A	probably damaging	Het
Lrrc8d	A	G	5: 105,812,492	N256S	probably benign	Het
Mindy1	C	T	3: 95,295,279	L394F	probably benign	Het
Mon2	A	G	10: 123,032,547	S534P	probably benign	Het
Mrps5	T	A	2: 127,595,814	I187N	probably benign	Het
Mto1	A	G	9: 78,457,558	M360V	probably benign	Het
Muc16	T	G	9: 18,642,224	I4258L	probably benign	Het
Myo10	A	G	15: 25,781,434	D1005G	possibly damaging	Het
Myo18b	T	A	5: 112,795,403	R1645S	possibly damaging	Het
Naip2	A	T	13: 100,161,572	V652D	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Ncapd2	A	T	6: 125,186,143	M134K	probably benign	Het
Nup107	A	G	10: 117,750,963	F893S	probably damaging	Het
Olfr1307	A	G	2: 111,945,084	V124A	probably benign	Het
Olfr218	A	T	1: 173,204,174	R273W	probably damaging	Het
Olfr395	A	T	11: 73,906,625	I289N	probably damaging	Het
Olfr488	C	T	7: 108,255,592	C182Y	probably damaging	Het
Olfr748	A	G	14: 50,710,345	E5G	probably benign	Het
Pcgf1	G	T	6: 83,079,452	R124L	probably benign	Het
Pdcd10	A	T	3: 75,541,226	N10K	probably damaging	Het
Pdx1	C	T	5: 147,270,254	Q6*	probably null	Het
Plcl1	T	C	1: 55,696,651	S384P	probably damaging	Het
Serpina1b	T	A	12: 103,728,394	T364S	possibly damaging	Het
Slc5a11	C	T	7: 123,258,552	T288I	probably damaging	Het
Slc6a1	A	T	6: 114,314,310	S515C	probably damaging	Het
Snca	A	T	6: 60,733,137	D119E	probably benign	Het
Sorcs2	T	C	5: 36,043,470	D578G	probably damaging	Het
Sulf1	T	A	1: 12,820,505	L389Q	probably damaging	Het
Tln1	A	C	4: 43,532,084	I2501S	possibly damaging	Het
Tmem191c	A	G	16: 17,276,393	E27G	probably damaging	Het
Tmem200a	G	T	10: 25,993,779	N197K	probably benign	Het
Tmem207	A	T	16: 26,526,684	S11T	probably benign	Het
Ttn	T	C	2: 76,734,609	T28425A	probably damaging	Het
Ush2a	C	T	1: 188,874,950	T4014M	probably benign	Het
Vac14	G	A	8: 110,712,747		probably null	Het
Vmn2r32	A	T	7: 7,474,198	I398K	probably damaging	Het
Vmn2r77	A	T	7: 86,803,028	H472L	probably benign	Het
Vps45	C	T	3: 96,033,664		probably null	Het
Wdr26	T	C	1: 181,191,858	H334R	probably damaging	Het
Zmynd10	A	G	9: 107,549,050	D132G	possibly damaging	Het
Zpbp2	A	G	11: 98,553,948	T123A	probably benign	Het

Other mutations in Heatr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Heatr1	APN	13	12410450	missense	probably benign	0.00
IGL00863:Heatr1	APN	13	12435128	missense	probably benign	0.02
IGL00899:Heatr1	APN	13	12435176	missense	probably benign	0.31
IGL01147:Heatr1	APN	13	12437912	missense	probably damaging	0.99
IGL01317:Heatr1	APN	13	12399027	missense	probably damaging	1.00
IGL01323:Heatr1	APN	13	12398938	missense	possibly damaging	0.86
IGL01625:Heatr1	APN	13	12413528	missense	probably damaging	0.98
IGL01973:Heatr1	APN	13	12429799	missense	probably benign
IGL02803:Heatr1	APN	13	12433986	missense	probably damaging	0.96
IGL02830:Heatr1	APN	13	12426212	missense	possibly damaging	0.57
IGL02956:Heatr1	APN	13	12416059	missense	possibly damaging	0.53
IGL03000:Heatr1	APN	13	12434411	missense	probably damaging	0.99
IGL03024:Heatr1	APN	13	12407509	unclassified	probably benign
IGL03035:Heatr1	APN	13	12413219	splice site	probably benign
IGL03301:Heatr1	APN	13	12434205	missense	probably damaging	1.00
hasan	UTSW	13	12417447	splice site	probably benign
H8562:Heatr1	UTSW	13	12408713	missense	probably benign	0.13
R0226:Heatr1	UTSW	13	12410562	missense	probably damaging	1.00
R0571:Heatr1	UTSW	13	12430240	missense	probably damaging	0.98
R0722:Heatr1	UTSW	13	12406037	missense	probably benign	0.14
R1264:Heatr1	UTSW	13	12424610	unclassified	probably benign
R1371:Heatr1	UTSW	13	12417632	missense	possibly damaging	0.80
R1388:Heatr1	UTSW	13	12417447	splice site	probably benign
R1396:Heatr1	UTSW	13	12406046	missense	possibly damaging	0.86
R1519:Heatr1	UTSW	13	12412159	missense	probably benign
R1689:Heatr1	UTSW	13	12424625	missense	probably benign	0.00
R1696:Heatr1	UTSW	13	12423721	missense	possibly damaging	0.96
R1756:Heatr1	UTSW	13	12396460	missense	probably benign	0.01
R1859:Heatr1	UTSW	13	12403159	missense	probably damaging	1.00
R1932:Heatr1	UTSW	13	12435185	missense	probably damaging	1.00
R1957:Heatr1	UTSW	13	12396538	missense	probably damaging	1.00
R2018:Heatr1	UTSW	13	12414478	missense	possibly damaging	0.68
R2106:Heatr1	UTSW	13	12412058	missense	probably benign	0.03
R2119:Heatr1	UTSW	13	12432646	missense	probably null	1.00
R2121:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2122:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2367:Heatr1	UTSW	13	12433724	missense	probably damaging	1.00
R3777:Heatr1	UTSW	13	12413348	missense	possibly damaging	0.92
R3783:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3784:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3786:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3787:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3843:Heatr1	UTSW	13	12435121	missense	probably benign	0.00
R4533:Heatr1	UTSW	13	12434511	missense	probably benign	0.05
R4725:Heatr1	UTSW	13	12424662	nonsense	probably null
R4763:Heatr1	UTSW	13	12430930	missense	possibly damaging	0.65
R4793:Heatr1	UTSW	13	12431837	missense	probably benign	0.00
R4797:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4798:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4942:Heatr1	UTSW	13	12413510	critical splice acceptor site	probably null
R4952:Heatr1	UTSW	13	12410599	missense	probably benign	0.38
R4954:Heatr1	UTSW	13	12407516	critical splice acceptor site	probably null
R5370:Heatr1	UTSW	13	12401522	missense	probably benign	0.02
R5464:Heatr1	UTSW	13	12433643	missense	probably benign	0.00
R5483:Heatr1	UTSW	13	12398914	missense	probably damaging	1.00
R5497:Heatr1	UTSW	13	12421064	missense	possibly damaging	0.93
R5504:Heatr1	UTSW	13	12406619	missense	possibly damaging	0.64
R5527:Heatr1	UTSW	13	12402760	missense	probably damaging	1.00
R5527:Heatr1	UTSW	13	12404948	missense	probably benign
R5836:Heatr1	UTSW	13	12408736	missense	probably damaging	0.99
R5916:Heatr1	UTSW	13	12434471	missense	probably damaging	1.00
R6018:Heatr1	UTSW	13	12404947	missense	probably benign
R6018:Heatr1	UTSW	13	12406058	missense	probably benign	0.26
R6216:Heatr1	UTSW	13	12432664	missense	probably benign	0.16
R6396:Heatr1	UTSW	13	12406097	missense	possibly damaging	0.86
R6472:Heatr1	UTSW	13	12434230	missense	probably benign	0.29
R6922:Heatr1	UTSW	13	12435075	missense	probably benign	0.00
R7077:Heatr1	UTSW	13	12418164	missense	possibly damaging	0.63
R7297:Heatr1	UTSW	13	12421060	nonsense	probably null
R7445:Heatr1	UTSW	13	12431038	missense	possibly damaging	0.70
R7669:Heatr1	UTSW	13	12411262	missense	probably benign	0.33
R7672:Heatr1	UTSW	13	12438664	missense	probably damaging	0.96
R7772:Heatr1	UTSW	13	12417641	missense	probably benign	0.03
R8205:Heatr1	UTSW	13	12416047	missense	probably benign
R8518:Heatr1	UTSW	13	12410534	missense	probably benign
R8754:Heatr1	UTSW	13	12413294	missense	probably damaging	0.99
R8874:Heatr1	UTSW	13	12430912	missense	probably damaging	1.00
R8992:Heatr1	UTSW	13	12401114	missense	probably damaging	0.98
R9045:Heatr1	UTSW	13	12413352	missense	probably benign	0.00
R9077:Heatr1	UTSW	13	12413366	missense	probably benign
R9183:Heatr1	UTSW	13	12421385	missense	probably damaging	0.99
R9186:Heatr1	UTSW	13	12421346	missense	probably damaging	1.00
R9223:Heatr1	UTSW	13	12404921	missense	probably benign	0.00
R9242:Heatr1	UTSW	13	12433925	missense	probably benign
R9267:Heatr1	UTSW	13	12406608	missense	probably damaging	1.00
R9289:Heatr1	UTSW	13	12432727	missense	probably benign	0.13
R9310:Heatr1	UTSW	13	12438610	missense	probably benign
R9312:Heatr1	UTSW	13	12431684	missense	probably benign
R9385:Heatr1	UTSW	13	12406542	missense	probably damaging	1.00
R9530:Heatr1	UTSW	13	12424726	missense	probably damaging	1.00
R9532:Heatr1	UTSW	13	12414425	missense	possibly damaging	0.72
R9647:Heatr1	UTSW	13	12426798	missense	probably benign	0.00
R9683:Heatr1	UTSW	13	12434259	missense	probably damaging	1.00
R9695:Heatr1	UTSW	13	12423743	missense	probably damaging	1.00
RF011:Heatr1	UTSW	13	12407544	missense	probably benign	0.00
Z1176:Heatr1	UTSW	13	12399008	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TCAGTGAGAACGGATTCCCA -3'
(R):5'- TGGGTTTTGAACTTCTCTAGTACA -3'

Sequencing Primer
(F):5'- GAACGGATTCCCAAAAGTTCTTCTC -3'
(R):5'- GATCCCAAAGGAACACTGTA -3'

Posted On

2022-04-18