Incidental Mutation 'R9359:Slco6c1'
ID 708563
Institutional Source Beutler Lab
Gene Symbol Slco6c1
Ensembl Gene ENSMUSG00000026331
Gene Name solute carrier organic anion transporter family, member 6c1
Synonyms 4933404A18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9359 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 97059038-97128301 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 97062523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 664 (S664R)
Ref Sequence ENSEMBL: ENSMUSP00000027569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027569] [ENSMUST00000189547]
AlphaFold Q8C0X7
Predicted Effect possibly damaging
Transcript: ENSMUST00000027569
AA Change: S664R

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027569
Gene: ENSMUSG00000026331
AA Change: S664R

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 95 654 3e-101 PFAM
Pfam:MFS_1 207 474 6.5e-14 PFAM
Pfam:Kazal_2 497 538 7.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189547
AA Change: S647R

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140791
Gene: ENSMUSG00000026331
AA Change: S647R

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 93 197 7.4e-12 PFAM
Pfam:MFS_1 99 457 2.2e-15 PFAM
Pfam:OATP 192 638 2.5e-64 PFAM
Pfam:Kazal_2 480 521 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Ankrd50 A T 3: 38,483,023 N60K probably damaging Het
Atp6v0a4 G A 6: 38,082,113 T245I probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Cyp2j13 T C 4: 96,061,933 D277G probably damaging Het
Def8 A T 8: 123,458,366 I310F probably benign Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Gabbr1 A G 17: 37,070,713 T790A probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm10549 C T 18: 33,464,322 P54S unknown Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Insr G C 8: 3,158,717 P1248R probably damaging Het
Ipcef1 C T 10: 6,890,663 D349N probably damaging Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mex3d A T 10: 80,381,747 N545K Het
Mios T A 6: 8,214,894 V30E probably benign Het
Muc16 A G 9: 18,537,764 probably null Het
Naxd A G 8: 11,512,968 K303E possibly damaging Het
Olfr1438-ps1 T A 19: 12,333,439 H139L possibly damaging Het
Olfr1497 C T 19: 13,794,836 M258I probably damaging Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Ptgdr A G 14: 44,853,258 S348P Het
Ptpdc1 T A 13: 48,586,554 E467V probably benign Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rfx4 A G 10: 84,905,057 T680A probably benign Het
Slc30a5 T C 13: 100,813,462 T371A probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Tbxa2r A G 10: 81,333,124 S216G probably damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Thoc6 A G 17: 23,668,849 V328A possibly damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Uspl1 G A 5: 149,209,671 V411M probably damaging Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Vps54 A G 11: 21,292,108 T408A probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in Slco6c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Slco6c1 APN 1 97087949 missense probably benign 0.00
IGL00571:Slco6c1 APN 1 97087951 missense probably benign 0.04
IGL01483:Slco6c1 APN 1 97128107 missense probably benign
IGL01543:Slco6c1 APN 1 97125828 missense possibly damaging 0.95
IGL01860:Slco6c1 APN 1 97075823 splice site probably benign
IGL03106:Slco6c1 APN 1 97066023 splice site probably benign
R0087:Slco6c1 UTSW 1 97118578 missense probably benign 0.00
R0543:Slco6c1 UTSW 1 97127898 missense probably damaging 0.99
R0674:Slco6c1 UTSW 1 97104773 splice site probably benign
R0826:Slco6c1 UTSW 1 97128101 missense probably benign 0.00
R0928:Slco6c1 UTSW 1 97104848 missense possibly damaging 0.88
R0969:Slco6c1 UTSW 1 97119960 missense probably benign 0.05
R1366:Slco6c1 UTSW 1 97128203 start gained probably null
R1559:Slco6c1 UTSW 1 97098498 missense probably damaging 1.00
R1594:Slco6c1 UTSW 1 97062438 missense probably benign 0.36
R1901:Slco6c1 UTSW 1 97072982 missense probably damaging 0.98
R2005:Slco6c1 UTSW 1 97081489 missense probably damaging 0.99
R2101:Slco6c1 UTSW 1 97072870 nonsense probably null
R2102:Slco6c1 UTSW 1 97127931 missense probably benign 0.02
R2120:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R2135:Slco6c1 UTSW 1 97104817 missense probably benign 0.01
R2295:Slco6c1 UTSW 1 97125748 missense probably damaging 1.00
R2437:Slco6c1 UTSW 1 97062476 missense probably benign 0.22
R4004:Slco6c1 UTSW 1 97075885 missense probably damaging 1.00
R4133:Slco6c1 UTSW 1 97081493 missense probably benign 0.02
R4643:Slco6c1 UTSW 1 97062424 missense probably benign 0.00
R4786:Slco6c1 UTSW 1 97087995 missense probably benign 0.04
R4942:Slco6c1 UTSW 1 97081324 missense probably damaging 1.00
R5485:Slco6c1 UTSW 1 97125756 missense probably damaging 1.00
R5573:Slco6c1 UTSW 1 97127931 missense probably benign 0.00
R5810:Slco6c1 UTSW 1 97075873 missense probably damaging 1.00
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6191:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R6197:Slco6c1 UTSW 1 97072793 critical splice donor site probably null
R6286:Slco6c1 UTSW 1 97125720 missense possibly damaging 0.90
R6404:Slco6c1 UTSW 1 97118605 missense probably damaging 1.00
R6430:Slco6c1 UTSW 1 97075974 missense probably benign 0.43
R6492:Slco6c1 UTSW 1 97125813 missense probably damaging 0.99
R6649:Slco6c1 UTSW 1 97125711 missense probably benign 0.44
R6940:Slco6c1 UTSW 1 97072901 missense possibly damaging 0.80
R7138:Slco6c1 UTSW 1 97119981 missense possibly damaging 0.95
R7213:Slco6c1 UTSW 1 97127946 missense probably benign
R7234:Slco6c1 UTSW 1 97125741 missense probably benign 0.06
R7320:Slco6c1 UTSW 1 97128162 missense possibly damaging 0.83
R7375:Slco6c1 UTSW 1 97081421 missense possibly damaging 0.58
R7383:Slco6c1 UTSW 1 97075883 nonsense probably null
R7422:Slco6c1 UTSW 1 97081482 missense probably benign 0.17
R7491:Slco6c1 UTSW 1 97127854 missense probably benign 0.32
R7561:Slco6c1 UTSW 1 97072966 missense probably damaging 1.00
R7890:Slco6c1 UTSW 1 97062467 missense possibly damaging 0.59
R8115:Slco6c1 UTSW 1 97072961 missense probably damaging 1.00
R8409:Slco6c1 UTSW 1 97075938 missense probably damaging 0.99
R8422:Slco6c1 UTSW 1 97125783 missense probably damaging 1.00
R8824:Slco6c1 UTSW 1 97128159 missense possibly damaging 0.84
R8905:Slco6c1 UTSW 1 97125666 missense possibly damaging 0.68
R9183:Slco6c1 UTSW 1 97069050 critical splice acceptor site probably null
R9300:Slco6c1 UTSW 1 97066084 missense probably benign 0.37
R9374:Slco6c1 UTSW 1 97128102 missense probably benign 0.00
R9403:Slco6c1 UTSW 1 97062523 missense possibly damaging 0.94
R9499:Slco6c1 UTSW 1 97128102 missense probably benign 0.00
R9551:Slco6c1 UTSW 1 97128102 missense probably benign 0.00
R9674:Slco6c1 UTSW 1 97119840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTGACAAAGTGAAAGTATACAA -3'
(R):5'- TGTACTTGCAATTTAGCATAGTTCA -3'

Sequencing Primer
(F):5'- CTCTCAGTGATTTCTCCATG -3'
(R):5'- GACATTACATCTGTGAGCTAT -3'
Posted On 2022-04-18