Incidental Mutation 'R9359:Maml2'
ID 708581
Institutional Source Beutler Lab
Gene Symbol Maml2
Ensembl Gene ENSMUSG00000031925
Gene Name mastermind like transcriptional coactivator 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9359 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 13297957-13709388 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 13621673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 728 (Q728*)
Ref Sequence ENSEMBL: ENSMUSP00000124083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034401] [ENSMUST00000159294]
AlphaFold F6U238
Predicted Effect probably benign
Transcript: ENSMUST00000034401
SMART Domains Protein: ENSMUSP00000034401
Gene: ENSMUSG00000031925

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159294
AA Change: Q728*
SMART Domains Protein: ENSMUSP00000124083
Gene: ENSMUSG00000031925
AA Change: Q728*

DomainStartEndE-ValueType
low complexity region 227 245 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
SCOP:d1lsha3 385 459 5e-3 SMART
low complexity region 523 547 N/A INTRINSIC
low complexity region 571 589 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Ankrd50 A T 3: 38,483,023 N60K probably damaging Het
Atp6v0a4 G A 6: 38,082,113 T245I probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Cyp2j13 T C 4: 96,061,933 D277G probably damaging Het
Def8 A T 8: 123,458,366 I310F probably benign Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Gabbr1 A G 17: 37,070,713 T790A probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm10549 C T 18: 33,464,322 P54S unknown Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Insr G C 8: 3,158,717 P1248R probably damaging Het
Ipcef1 C T 10: 6,890,663 D349N probably damaging Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Malrd1 T C 2: 15,614,177 V284A Het
Mex3d A T 10: 80,381,747 N545K Het
Mios T A 6: 8,214,894 V30E probably benign Het
Muc16 A G 9: 18,537,764 probably null Het
Naxd A G 8: 11,512,968 K303E possibly damaging Het
Olfr1438-ps1 T A 19: 12,333,439 H139L possibly damaging Het
Olfr1497 C T 19: 13,794,836 M258I probably damaging Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Ptgdr A G 14: 44,853,258 S348P Het
Ptpdc1 T A 13: 48,586,554 E467V probably benign Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rfx4 A G 10: 84,905,057 T680A probably benign Het
Slc30a5 T C 13: 100,813,462 T371A probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tbxa2r A G 10: 81,333,124 S216G probably damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Thoc6 A G 17: 23,668,849 V328A possibly damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Uspl1 G A 5: 149,209,671 V411M probably damaging Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Vps54 A G 11: 21,292,108 T408A probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in Maml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Maml2 APN 9 13621604 unclassified probably benign
IGL00424:Maml2 APN 9 13620912 missense probably damaging 0.99
IGL02711:Maml2 APN 9 13620063 missense probably benign 0.14
IGL03079:Maml2 APN 9 13621616 unclassified probably benign
IGL03217:Maml2 APN 9 13619999 missense probably damaging 1.00
FR4304:Maml2 UTSW 9 13621459 small deletion probably benign
FR4449:Maml2 UTSW 9 13621456 small deletion probably benign
PIT4810001:Maml2 UTSW 9 13620024 missense
R0102:Maml2 UTSW 9 13705932 synonymous silent
R0318:Maml2 UTSW 9 13620594 missense probably damaging 0.99
R0380:Maml2 UTSW 9 13621100 nonsense probably null
R1433:Maml2 UTSW 9 13706501 missense probably damaging 1.00
R1449:Maml2 UTSW 9 13620684 missense possibly damaging 0.85
R1789:Maml2 UTSW 9 13697345 missense probably damaging 1.00
R2173:Maml2 UTSW 9 13621616 unclassified probably benign
R2363:Maml2 UTSW 9 13621245 missense probably damaging 1.00
R2426:Maml2 UTSW 9 13706498 missense probably damaging 1.00
R2880:Maml2 UTSW 9 13620597 splice site probably null
R3981:Maml2 UTSW 9 13621068 missense possibly damaging 0.80
R4094:Maml2 UTSW 9 13620153 missense probably benign 0.22
R4117:Maml2 UTSW 9 13705934 missense probably damaging 1.00
R4282:Maml2 UTSW 9 13620110 missense possibly damaging 0.93
R4618:Maml2 UTSW 9 13620075 missense probably damaging 1.00
R4921:Maml2 UTSW 9 13621175 missense probably damaging 1.00
R4957:Maml2 UTSW 9 13620276 missense probably damaging 1.00
R5195:Maml2 UTSW 9 13621114 missense probably damaging 0.98
R5428:Maml2 UTSW 9 13705895 missense probably benign 0.30
R5448:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5450:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5455:Maml2 UTSW 9 13705743 nonsense probably null
R5620:Maml2 UTSW 9 13697320 missense probably damaging 1.00
R5973:Maml2 UTSW 9 13621619 unclassified probably benign
R6009:Maml2 UTSW 9 13620998 missense probably benign 0.02
R6054:Maml2 UTSW 9 13621399 small deletion probably benign
R6257:Maml2 UTSW 9 13620426 missense probably damaging 1.00
R6727:Maml2 UTSW 9 13621551 unclassified probably benign
R6824:Maml2 UTSW 9 13697217 missense possibly damaging 0.67
R6854:Maml2 UTSW 9 13705835 missense possibly damaging 0.59
R6998:Maml2 UTSW 9 13621185 unclassified probably benign
R7047:Maml2 UTSW 9 13620881 unclassified probably benign
R7233:Maml2 UTSW 9 13620771 missense
R7326:Maml2 UTSW 9 13621607 missense
R7612:Maml2 UTSW 9 13706485 missense probably benign 0.04
R7652:Maml2 UTSW 9 13621649 missense
R7699:Maml2 UTSW 9 13621089 missense
R7700:Maml2 UTSW 9 13621089 missense
R7803:Maml2 UTSW 9 13621254 small insertion probably benign
R7803:Maml2 UTSW 9 13621275 small insertion probably benign
R7803:Maml2 UTSW 9 13621276 small insertion probably benign
R8425:Maml2 UTSW 9 13620117 missense
R8810:Maml2 UTSW 9 13621622 missense
R9277:Maml2 UTSW 9 13620576 missense
R9403:Maml2 UTSW 9 13621673 nonsense probably null
RF015:Maml2 UTSW 9 13621456 small deletion probably benign
RF044:Maml2 UTSW 9 13621456 small deletion probably benign
X0063:Maml2 UTSW 9 13620341 missense probably benign 0.09
Z1177:Maml2 UTSW 9 13706590 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGCCTTCCCAGAGCAAAC -3'
(R):5'- TCACTGATCATTACAGATCCCC -3'

Sequencing Primer
(F):5'- AGGTTCATTGACAGCTCAGC -3'
(R):5'- TGATCATTACAGATCCCCCAAGC -3'
Posted On 2022-04-18