Incidental Mutation 'R9360:Hormad1'
ID 708614
Institutional Source Beutler Lab
Gene Symbol Hormad1
Ensembl Gene ENSMUSG00000028109
Gene Name HORMA domain containing 1
Synonyms 4921522K05Rik, Nohma
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9360 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 95466988-95494982 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 95483622 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 145 (A145T)
Ref Sequence ENSEMBL: ENSMUSP00000029754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029754] [ENSMUST00000090797] [ENSMUST00000107154] [ENSMUST00000171191]
AlphaFold Q9D5T7
Predicted Effect probably benign
Transcript: ENSMUST00000029754
AA Change: A145T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029754
Gene: ENSMUSG00000028109
AA Change: A145T

DomainStartEndE-ValueType
Pfam:HORMA 24 221 4.7e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090797
AA Change: A145T

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088303
Gene: ENSMUSG00000028109
AA Change: A145T

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107154
AA Change: A145T

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102772
Gene: ENSMUSG00000028109
AA Change: A145T

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171191
AA Change: A145T

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127180
Gene: ENSMUSG00000028109
AA Change: A145T

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HORMA domain-containing protein. HORMA domains are involved in chromatin binding and play a role in cell cycle regulation. The encoded protein may play a role in meiosis, and expression of this gene is a potential marker for cancer. A pseudogene of this gene is located on the long arm of chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozgous mice are infertile because of meiosis arrest associated with impaired synaptonemal-complex formation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A G 12: 81,468,261 (GRCm39) L120P probably damaging Het
Asb6 A G 2: 30,714,334 (GRCm39) S259P probably damaging Het
Atp6v0a2 C A 5: 124,767,259 (GRCm39) S7R possibly damaging Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Cacna1h G A 17: 25,594,336 (GRCm39) A2274V probably benign Het
Caml A C 13: 55,771,030 (GRCm39) N43H probably damaging Het
Ccar2 A G 14: 70,379,445 (GRCm39) S518P probably damaging Het
Cdkl3 A G 11: 51,924,349 (GRCm39) I546V probably null Het
Chac1 C T 2: 119,182,854 (GRCm39) T84I probably damaging Het
Col6a6 T C 9: 105,644,686 (GRCm39) T1201A probably benign Het
Csf1 T C 3: 107,661,158 (GRCm39) T120A possibly damaging Het
Ctsj T A 13: 61,151,634 (GRCm39) I95F probably benign Het
Cyp4f17 C T 17: 32,743,880 (GRCm39) R353C probably benign Het
Depdc1a A G 3: 159,232,168 (GRCm39) M640V possibly damaging Het
Dgkq A G 5: 108,798,469 (GRCm39) V633A probably damaging Het
Fdft1 A T 14: 63,415,189 (GRCm39) Y14* probably null Het
Fktn G A 4: 53,734,854 (GRCm39) G125D probably benign Het
Ftdc1 T C 16: 58,434,234 (GRCm39) D161G probably benign Het
Gfm2 T A 13: 97,289,752 (GRCm39) V179E probably damaging Het
Gpr12 A G 5: 146,520,299 (GRCm39) F208L probably benign Het
Greb1 A G 12: 16,790,037 (GRCm39) S4P probably damaging Het
Hlcs A T 16: 93,932,672 (GRCm39) I717N probably damaging Het
Kcmf1 A T 6: 72,838,826 (GRCm39) C33* probably null Het
Kif13a A T 13: 46,962,472 (GRCm39) S561T probably benign Het
Klhl20 G T 1: 160,921,269 (GRCm39) P571Q probably benign Het
Kpna6 A T 4: 129,547,635 (GRCm39) M304K probably benign Het
Krt75 T C 15: 101,476,729 (GRCm39) K387E probably damaging Het
Lum A T 10: 97,404,752 (GRCm39) K216* probably null Het
Meioc A G 11: 102,565,779 (GRCm39) N409S probably benign Het
Mrpl20 T C 4: 155,888,402 (GRCm39) probably null Het
Naa16 A T 14: 79,593,943 (GRCm39) I374N probably benign Het
Nbea A G 3: 55,943,319 (GRCm39) I652T possibly damaging Het
Nhsl1 G A 10: 18,194,898 (GRCm39) G56R probably damaging Het
Obscn T C 11: 58,973,650 (GRCm39) I1894V probably benign Het
Olig2 A C 16: 91,023,774 (GRCm39) T163P probably damaging Het
Or13c7c A G 4: 43,835,765 (GRCm39) S242P probably benign Het
Or4g7 T C 2: 111,309,684 (GRCm39) I185T probably benign Het
Or5p81 T A 7: 108,266,977 (GRCm39) L118Q probably damaging Het
Or7e168 T A 9: 19,720,529 (GRCm39) V305D possibly damaging Het
Parp4 G A 14: 56,878,775 (GRCm39) probably null Het
Pcdhb2 T C 18: 37,429,551 (GRCm39) I508T probably damaging Het
Pcdhga8 T C 18: 37,859,787 (GRCm39) F281S probably damaging Het
Pom121l12 T A 11: 14,549,516 (GRCm39) M74K possibly damaging Het
Pramel39-ps G T 5: 94,451,001 (GRCm39) P375H probably damaging Het
Prpf8 T C 11: 75,381,156 (GRCm39) Y219H possibly damaging Het
Rhag T C 17: 41,142,548 (GRCm39) V251A possibly damaging Het
Rrs1 A G 1: 9,616,845 (GRCm39) *366W probably null Het
Sgpp2 A G 1: 78,367,143 (GRCm39) D92G probably damaging Het
Slc44a3 C A 3: 121,325,908 (GRCm39) probably benign Het
Smg8 T C 11: 86,968,956 (GRCm39) M257V probably benign Het
Taar7e T A 10: 23,913,949 (GRCm39) Y146* probably null Het
Tet2 G T 3: 133,192,903 (GRCm39) N510K possibly damaging Het
Tgfbr3 T C 5: 107,257,550 (GRCm39) I836M unknown Het
Thada A G 17: 84,499,410 (GRCm39) V1929A probably benign Het
Tram1l1 A T 3: 124,115,899 (GRCm39) D353V probably damaging Het
Trf T A 9: 103,094,734 (GRCm39) probably null Het
Trim15 A T 17: 37,177,942 (GRCm39) C18S probably damaging Het
Vmn1r62 T C 7: 5,678,952 (GRCm39) I211T probably damaging Het
Zdhhc17 A G 10: 110,783,165 (GRCm39) V501A probably benign Het
Zfp563 A G 17: 33,324,428 (GRCm39) E341G probably benign Het
Other mutations in Hormad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Hormad1 APN 3 95,485,608 (GRCm39) missense possibly damaging 0.49
IGL01686:Hormad1 APN 3 95,485,580 (GRCm39) missense probably benign 0.02
IGL02023:Hormad1 APN 3 95,485,604 (GRCm39) missense possibly damaging 0.91
B6584:Hormad1 UTSW 3 95,478,007 (GRCm39) splice site probably benign
R0025:Hormad1 UTSW 3 95,492,436 (GRCm39) unclassified probably benign
R0662:Hormad1 UTSW 3 95,482,910 (GRCm39) missense probably benign 0.01
R0704:Hormad1 UTSW 3 95,473,997 (GRCm39) critical splice donor site probably null
R1854:Hormad1 UTSW 3 95,487,317 (GRCm39) missense probably benign 0.08
R2199:Hormad1 UTSW 3 95,475,033 (GRCm39) critical splice donor site probably null
R2371:Hormad1 UTSW 3 95,482,910 (GRCm39) missense probably benign 0.18
R2411:Hormad1 UTSW 3 95,487,326 (GRCm39) missense probably benign 0.41
R3522:Hormad1 UTSW 3 95,483,596 (GRCm39) missense probably benign 0.01
R4075:Hormad1 UTSW 3 95,485,514 (GRCm39) missense possibly damaging 0.47
R4202:Hormad1 UTSW 3 95,492,509 (GRCm39) missense probably benign 0.00
R4535:Hormad1 UTSW 3 95,492,452 (GRCm39) missense probably benign 0.00
R4536:Hormad1 UTSW 3 95,492,452 (GRCm39) missense probably benign 0.00
R4844:Hormad1 UTSW 3 95,478,242 (GRCm39) missense probably damaging 0.98
R4903:Hormad1 UTSW 3 95,492,531 (GRCm39) splice site probably null
R4964:Hormad1 UTSW 3 95,492,531 (GRCm39) splice site probably null
R5135:Hormad1 UTSW 3 95,492,531 (GRCm39) unclassified probably benign
R5208:Hormad1 UTSW 3 95,485,418 (GRCm39) missense possibly damaging 0.46
R5372:Hormad1 UTSW 3 95,483,735 (GRCm39) missense probably damaging 1.00
R5825:Hormad1 UTSW 3 95,469,870 (GRCm39) missense probably damaging 0.97
R5895:Hormad1 UTSW 3 95,467,044 (GRCm39) critical splice donor site probably null
R6124:Hormad1 UTSW 3 95,483,613 (GRCm39) missense probably benign
R6453:Hormad1 UTSW 3 95,485,568 (GRCm39) missense probably benign 0.02
R7308:Hormad1 UTSW 3 95,469,866 (GRCm39) missense probably damaging 0.99
R7373:Hormad1 UTSW 3 95,483,628 (GRCm39) missense probably damaging 1.00
R8744:Hormad1 UTSW 3 95,469,926 (GRCm39) missense possibly damaging 0.79
R9040:Hormad1 UTSW 3 95,487,470 (GRCm39) missense possibly damaging 0.68
R9790:Hormad1 UTSW 3 95,494,693 (GRCm39) missense probably benign 0.13
R9791:Hormad1 UTSW 3 95,494,693 (GRCm39) missense probably benign 0.13
X0025:Hormad1 UTSW 3 95,488,878 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACAAGACAAAATTATGTGC -3'
(R):5'- GACTCTGCAACAATTTAGGTGCC -3'

Sequencing Primer
(F):5'- AGTATTTGAGTGGTTAGAA -3'
(R):5'- TCTGCAACAATTTAGGTGCCAAAAC -3'
Posted On 2022-04-18