Incidental Mutation 'R9360:Slc44a3'
ID 708616
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Name solute carrier family 44, member 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9360 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 121459528-121532404 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to A at 121532259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039197]
AlphaFold Q921V7
Predicted Effect probably benign
Transcript: ENSMUST00000039197
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Adam4 A G 12: 81,421,487 L120P probably damaging Het
Asb6 A G 2: 30,824,322 S259P probably damaging Het
Atp6v0a2 C A 5: 124,629,194 S7R possibly damaging Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Cacna1h G A 17: 25,375,362 A2274V probably benign Het
Caml A C 13: 55,623,217 N43H probably damaging Het
Ccar2 A G 14: 70,141,996 S518P probably damaging Het
Cdkl3 A G 11: 52,033,522 I546V probably null Het
Chac1 C T 2: 119,352,373 T84I probably damaging Het
Col6a6 T C 9: 105,767,487 T1201A probably benign Het
Csf1 T C 3: 107,753,842 T120A possibly damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Cyp4f17 C T 17: 32,524,906 R353C probably benign Het
Depdc1a A G 3: 159,526,531 M640V possibly damaging Het
Dgkq A G 5: 108,650,603 V633A probably damaging Het
Fdft1 A T 14: 63,177,740 Y14* probably null Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gfm2 T A 13: 97,153,244 V179E probably damaging Het
Gm813 T C 16: 58,613,871 D161G probably benign Het
Gpr12 A G 5: 146,583,489 F208L probably benign Het
Greb1 A G 12: 16,740,036 S4P probably damaging Het
Hlcs A T 16: 94,131,813 I717N probably damaging Het
Hormad1 G A 3: 95,576,311 A145T probably benign Het
Kcmf1 A T 6: 72,861,843 C33* probably null Het
Kif13a A T 13: 46,808,996 S561T probably benign Het
Klhl20 G T 1: 161,093,699 P571Q probably benign Het
Kpna6 A T 4: 129,653,842 M304K probably benign Het
Krt75 T C 15: 101,568,294 K387E probably damaging Het
Lum A T 10: 97,568,890 K216* probably null Het
Meioc A G 11: 102,674,953 N409S probably benign Het
Mrpl20 T C 4: 155,803,945 probably null Het
Naa16 A T 14: 79,356,503 I374N probably benign Het
Nbea A G 3: 56,035,898 I652T possibly damaging Het
Nhsl1 G A 10: 18,319,150 G56R probably damaging Het
Obscn T C 11: 59,082,824 I1894V probably benign Het
Olfr1288 T C 2: 111,479,339 I185T probably benign Het
Olfr157 A G 4: 43,835,765 S242P probably benign Het
Olfr510 T A 7: 108,667,770 L118Q probably damaging Het
Olfr859 T A 9: 19,809,233 V305D possibly damaging Het
Olig2 A C 16: 91,226,886 T163P probably damaging Het
Parp4 G A 14: 56,641,318 probably null Het
Pcdhb2 T C 18: 37,296,498 I508T probably damaging Het
Pcdhga8 T C 18: 37,726,734 F281S probably damaging Het
Pom121l12 T A 11: 14,599,516 M74K possibly damaging Het
Prpf8 T C 11: 75,490,330 Y219H possibly damaging Het
Rhag T C 17: 40,831,657 V251A possibly damaging Het
Rrs1 A G 1: 9,546,620 *366W probably null Het
Sgpp2 A G 1: 78,390,506 D92G probably damaging Het
Smg8 T C 11: 87,078,130 M257V probably benign Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tet2 G T 3: 133,487,142 N510K possibly damaging Het
Tgfbr3 T C 5: 107,109,684 I836M unknown Het
Thada A G 17: 84,191,982 V1929A probably benign Het
Tram1l1 A T 3: 124,322,250 D353V probably damaging Het
Trf T A 9: 103,217,535 probably null Het
Trim15 A T 17: 36,867,050 C18S probably damaging Het
Vmn1r62 T C 7: 5,675,953 I211T probably damaging Het
Zdhhc17 A G 10: 110,947,304 V501A probably benign Het
Zfp563 A G 17: 33,105,454 E341G probably benign Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
BB009:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
BB019:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R0668:Slc44a3 UTSW 3 121510203 missense probably damaging 0.96
R1355:Slc44a3 UTSW 3 121531671 missense probably damaging 1.00
R1608:Slc44a3 UTSW 3 121497847 nonsense probably null
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5302:Slc44a3 UTSW 3 121510313 missense probably damaging 1.00
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
R7197:Slc44a3 UTSW 3 121525762 missense probably benign 0.02
R7227:Slc44a3 UTSW 3 121510230 missense possibly damaging 0.93
R7272:Slc44a3 UTSW 3 121461115 missense probably damaging 0.99
R7932:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R8104:Slc44a3 UTSW 3 121497872 missense probably benign 0.01
R8529:Slc44a3 UTSW 3 121525685 missense probably benign 0.36
R8679:Slc44a3 UTSW 3 121490269 missense probably damaging 1.00
R8856:Slc44a3 UTSW 3 121513807 missense probably damaging 1.00
R9053:Slc44a3 UTSW 3 121527190 missense probably damaging 1.00
R9121:Slc44a3 UTSW 3 121461137 missense probably benign 0.00
Z1176:Slc44a3 UTSW 3 121532251 start gained probably benign
Z1177:Slc44a3 UTSW 3 121497750 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGTTTATCTCCCAAAGGACAGAGG -3'
(R):5'- ACTTCTAACTCCAGGCGCTG -3'

Sequencing Primer
(F):5'- CCCAAAGGACAGAGGAGCCG -3'
(R):5'- AGGCGTCGCACAGTGGTC -3'
Posted On 2022-04-18