Incidental Mutation 'R9360:Atp6v0a2'
ID 708627
Institutional Source Beutler Lab
Gene Symbol Atp6v0a2
Ensembl Gene ENSMUSG00000038023
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2, TJ6s
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R9360 (G1)
Quality Score 104.008
Status Not validated
Chromosome 5
Chromosomal Location 124767117-124801519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 124767259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 7 (S7R)
Ref Sequence ENSEMBL: ENSMUSP00000039737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]
AlphaFold P15920
PDB Structure NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037865
AA Change: S7R

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: S7R

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198382
AA Change: S7R

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023
AA Change: S7R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A G 12: 81,468,261 (GRCm39) L120P probably damaging Het
Asb6 A G 2: 30,714,334 (GRCm39) S259P probably damaging Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Cacna1h G A 17: 25,594,336 (GRCm39) A2274V probably benign Het
Caml A C 13: 55,771,030 (GRCm39) N43H probably damaging Het
Ccar2 A G 14: 70,379,445 (GRCm39) S518P probably damaging Het
Cdkl3 A G 11: 51,924,349 (GRCm39) I546V probably null Het
Chac1 C T 2: 119,182,854 (GRCm39) T84I probably damaging Het
Col6a6 T C 9: 105,644,686 (GRCm39) T1201A probably benign Het
Csf1 T C 3: 107,661,158 (GRCm39) T120A possibly damaging Het
Ctsj T A 13: 61,151,634 (GRCm39) I95F probably benign Het
Cyp4f17 C T 17: 32,743,880 (GRCm39) R353C probably benign Het
Depdc1a A G 3: 159,232,168 (GRCm39) M640V possibly damaging Het
Dgkq A G 5: 108,798,469 (GRCm39) V633A probably damaging Het
Fdft1 A T 14: 63,415,189 (GRCm39) Y14* probably null Het
Fktn G A 4: 53,734,854 (GRCm39) G125D probably benign Het
Ftdc1 T C 16: 58,434,234 (GRCm39) D161G probably benign Het
Gfm2 T A 13: 97,289,752 (GRCm39) V179E probably damaging Het
Gpr12 A G 5: 146,520,299 (GRCm39) F208L probably benign Het
Greb1 A G 12: 16,790,037 (GRCm39) S4P probably damaging Het
Hlcs A T 16: 93,932,672 (GRCm39) I717N probably damaging Het
Hormad1 G A 3: 95,483,622 (GRCm39) A145T probably benign Het
Kcmf1 A T 6: 72,838,826 (GRCm39) C33* probably null Het
Kif13a A T 13: 46,962,472 (GRCm39) S561T probably benign Het
Klhl20 G T 1: 160,921,269 (GRCm39) P571Q probably benign Het
Kpna6 A T 4: 129,547,635 (GRCm39) M304K probably benign Het
Krt75 T C 15: 101,476,729 (GRCm39) K387E probably damaging Het
Lum A T 10: 97,404,752 (GRCm39) K216* probably null Het
Meioc A G 11: 102,565,779 (GRCm39) N409S probably benign Het
Mrpl20 T C 4: 155,888,402 (GRCm39) probably null Het
Naa16 A T 14: 79,593,943 (GRCm39) I374N probably benign Het
Nbea A G 3: 55,943,319 (GRCm39) I652T possibly damaging Het
Nhsl1 G A 10: 18,194,898 (GRCm39) G56R probably damaging Het
Obscn T C 11: 58,973,650 (GRCm39) I1894V probably benign Het
Olig2 A C 16: 91,023,774 (GRCm39) T163P probably damaging Het
Or13c7c A G 4: 43,835,765 (GRCm39) S242P probably benign Het
Or4g7 T C 2: 111,309,684 (GRCm39) I185T probably benign Het
Or5p81 T A 7: 108,266,977 (GRCm39) L118Q probably damaging Het
Or7e168 T A 9: 19,720,529 (GRCm39) V305D possibly damaging Het
Parp4 G A 14: 56,878,775 (GRCm39) probably null Het
Pcdhb2 T C 18: 37,429,551 (GRCm39) I508T probably damaging Het
Pcdhga8 T C 18: 37,859,787 (GRCm39) F281S probably damaging Het
Pom121l12 T A 11: 14,549,516 (GRCm39) M74K possibly damaging Het
Pramel39-ps G T 5: 94,451,001 (GRCm39) P375H probably damaging Het
Prpf8 T C 11: 75,381,156 (GRCm39) Y219H possibly damaging Het
Rhag T C 17: 41,142,548 (GRCm39) V251A possibly damaging Het
Rrs1 A G 1: 9,616,845 (GRCm39) *366W probably null Het
Sgpp2 A G 1: 78,367,143 (GRCm39) D92G probably damaging Het
Slc44a3 C A 3: 121,325,908 (GRCm39) probably benign Het
Smg8 T C 11: 86,968,956 (GRCm39) M257V probably benign Het
Taar7e T A 10: 23,913,949 (GRCm39) Y146* probably null Het
Tet2 G T 3: 133,192,903 (GRCm39) N510K possibly damaging Het
Tgfbr3 T C 5: 107,257,550 (GRCm39) I836M unknown Het
Thada A G 17: 84,499,410 (GRCm39) V1929A probably benign Het
Tram1l1 A T 3: 124,115,899 (GRCm39) D353V probably damaging Het
Trf T A 9: 103,094,734 (GRCm39) probably null Het
Trim15 A T 17: 37,177,942 (GRCm39) C18S probably damaging Het
Vmn1r62 T C 7: 5,678,952 (GRCm39) I211T probably damaging Het
Zdhhc17 A G 10: 110,783,165 (GRCm39) V501A probably benign Het
Zfp563 A G 17: 33,324,428 (GRCm39) E341G probably benign Het
Other mutations in Atp6v0a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp6v0a2 APN 5 124,798,841 (GRCm39) missense probably benign 0.19
IGL01310:Atp6v0a2 APN 5 124,783,968 (GRCm39) missense probably damaging 1.00
IGL01944:Atp6v0a2 APN 5 124,774,043 (GRCm39) missense probably benign 0.04
IGL02044:Atp6v0a2 APN 5 124,783,954 (GRCm39) missense probably benign 0.00
IGL02400:Atp6v0a2 APN 5 124,798,849 (GRCm39) missense probably benign
IGL02650:Atp6v0a2 APN 5 124,789,426 (GRCm39) splice site probably benign
IGL02687:Atp6v0a2 APN 5 124,791,206 (GRCm39) missense possibly damaging 0.67
IGL02965:Atp6v0a2 APN 5 124,767,267 (GRCm39) missense possibly damaging 0.85
IGL03049:Atp6v0a2 APN 5 124,789,845 (GRCm39) missense probably damaging 1.00
IGL03088:Atp6v0a2 APN 5 124,791,171 (GRCm39) splice site probably benign
IGL03198:Atp6v0a2 APN 5 124,789,425 (GRCm39) critical splice donor site probably null
alkaline UTSW 5 124,796,930 (GRCm39) missense probably damaging 1.00
basic UTSW 5 124,789,392 (GRCm39) nonsense probably null
electronegative UTSW 5 124,784,638 (GRCm39) missense probably damaging 1.00
energizer UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
Everready UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
Lithium UTSW 5 124,791,209 (GRCm39) missense probably damaging 1.00
R0128:Atp6v0a2 UTSW 5 124,790,248 (GRCm39) missense probably damaging 1.00
R0594:Atp6v0a2 UTSW 5 124,795,046 (GRCm39) missense probably benign 0.01
R1540:Atp6v0a2 UTSW 5 124,784,638 (GRCm39) missense probably damaging 1.00
R2136:Atp6v0a2 UTSW 5 124,795,552 (GRCm39) missense possibly damaging 0.78
R2921:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R2922:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R2923:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R3055:Atp6v0a2 UTSW 5 124,765,209 (GRCm39) unclassified probably benign
R3889:Atp6v0a2 UTSW 5 124,777,203 (GRCm39) missense probably damaging 1.00
R3893:Atp6v0a2 UTSW 5 124,777,203 (GRCm39) missense probably damaging 1.00
R4013:Atp6v0a2 UTSW 5 124,789,860 (GRCm39) missense probably damaging 1.00
R4490:Atp6v0a2 UTSW 5 124,784,674 (GRCm39) missense probably damaging 1.00
R4791:Atp6v0a2 UTSW 5 124,784,667 (GRCm39) missense probably benign 0.17
R5219:Atp6v0a2 UTSW 5 124,790,249 (GRCm39) missense probably damaging 1.00
R5247:Atp6v0a2 UTSW 5 124,790,241 (GRCm39) missense probably damaging 1.00
R5293:Atp6v0a2 UTSW 5 124,784,649 (GRCm39) missense probably benign 0.00
R5620:Atp6v0a2 UTSW 5 124,783,909 (GRCm39) nonsense probably null
R5830:Atp6v0a2 UTSW 5 124,779,485 (GRCm39) missense probably damaging 1.00
R5875:Atp6v0a2 UTSW 5 124,793,391 (GRCm39) missense probably benign
R5903:Atp6v0a2 UTSW 5 124,789,343 (GRCm39) missense probably damaging 1.00
R6192:Atp6v0a2 UTSW 5 124,767,268 (GRCm39) missense probably benign 0.01
R6425:Atp6v0a2 UTSW 5 124,790,194 (GRCm39) missense probably damaging 1.00
R6752:Atp6v0a2 UTSW 5 124,779,452 (GRCm39) missense probably damaging 1.00
R6919:Atp6v0a2 UTSW 5 124,789,225 (GRCm39) splice site probably null
R6994:Atp6v0a2 UTSW 5 124,791,209 (GRCm39) missense probably damaging 1.00
R7053:Atp6v0a2 UTSW 5 124,783,923 (GRCm39) missense probably damaging 1.00
R7268:Atp6v0a2 UTSW 5 124,796,930 (GRCm39) missense probably damaging 1.00
R7342:Atp6v0a2 UTSW 5 124,784,676 (GRCm39) missense probably damaging 1.00
R7349:Atp6v0a2 UTSW 5 124,789,392 (GRCm39) nonsense probably null
R7714:Atp6v0a2 UTSW 5 124,775,533 (GRCm39) missense probably damaging 1.00
R7715:Atp6v0a2 UTSW 5 124,791,262 (GRCm39) missense probably damaging 0.99
R7748:Atp6v0a2 UTSW 5 124,793,560 (GRCm39) missense probably benign 0.00
R7775:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7778:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7824:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7833:Atp6v0a2 UTSW 5 124,782,969 (GRCm39) missense probably damaging 1.00
R7901:Atp6v0a2 UTSW 5 124,779,485 (GRCm39) missense probably damaging 1.00
R7977:Atp6v0a2 UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
R7987:Atp6v0a2 UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
R8118:Atp6v0a2 UTSW 5 124,789,837 (GRCm39) missense probably damaging 0.98
R8728:Atp6v0a2 UTSW 5 124,796,152 (GRCm39) missense probably benign 0.00
R8765:Atp6v0a2 UTSW 5 124,793,534 (GRCm39) missense probably damaging 1.00
R8945:Atp6v0a2 UTSW 5 124,784,589 (GRCm39) missense probably damaging 1.00
R8971:Atp6v0a2 UTSW 5 124,797,061 (GRCm39) missense probably damaging 1.00
R9023:Atp6v0a2 UTSW 5 124,796,138 (GRCm39) missense possibly damaging 0.93
R9300:Atp6v0a2 UTSW 5 124,789,312 (GRCm39) missense probably damaging 0.98
R9601:Atp6v0a2 UTSW 5 124,790,257 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGGTCAATCTGCGGTGG -3'
(R):5'- TTGGCTACCCTGCAAAGCAAC -3'

Sequencing Primer
(F):5'- AACCGGAACcggctgcg -3'
(R):5'- AACCTCCCTGCCCGAGTC -3'
Posted On 2022-04-18