Mutagenetix > Incidental Mutation

Incidental Mutation 'R9360:Atp6v0a2'

708627

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R9360 (G1)

Quality Score

104.008

Status

Not validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 124629194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 7 (S7R)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037865
AA Change: S7R

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: S7R

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000198382
AA Change: S7R

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023
AA Change: S7R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430089I19Rik	G	T	5: 94,303,142	P375H	probably damaging	Het
Adam4	A	G	12: 81,421,487	L120P	probably damaging	Het
Asb6	A	G	2: 30,824,322	S259P	probably damaging	Het
Btbd16	C	T	7: 130,815,786	R344C	probably damaging	Het
Cacna1h	G	A	17: 25,375,362	A2274V	probably benign	Het
Caml	A	C	13: 55,623,217	N43H	probably damaging	Het
Ccar2	A	G	14: 70,141,996	S518P	probably damaging	Het
Cdkl3	A	G	11: 52,033,522	I546V	probably null	Het
Chac1	C	T	2: 119,352,373	T84I	probably damaging	Het
Col6a6	T	C	9: 105,767,487	T1201A	probably benign	Het
Csf1	T	C	3: 107,753,842	T120A	possibly damaging	Het
Ctsj	T	A	13: 61,003,820	I95F	probably benign	Het
Cyp4f17	C	T	17: 32,524,906	R353C	probably benign	Het
Depdc1a	A	G	3: 159,526,531	M640V	possibly damaging	Het
Dgkq	A	G	5: 108,650,603	V633A	probably damaging	Het
Fdft1	A	T	14: 63,177,740	Y14*	probably null	Het
Fktn	G	A	4: 53,734,854	G125D	probably benign	Het
Gfm2	T	A	13: 97,153,244	V179E	probably damaging	Het
Gm813	T	C	16: 58,613,871	D161G	probably benign	Het
Gpr12	A	G	5: 146,583,489	F208L	probably benign	Het
Greb1	A	G	12: 16,740,036	S4P	probably damaging	Het
Hlcs	A	T	16: 94,131,813	I717N	probably damaging	Het
Hormad1	G	A	3: 95,576,311	A145T	probably benign	Het
Kcmf1	A	T	6: 72,861,843	C33*	probably null	Het
Kif13a	A	T	13: 46,808,996	S561T	probably benign	Het
Klhl20	G	T	1: 161,093,699	P571Q	probably benign	Het
Kpna6	A	T	4: 129,653,842	M304K	probably benign	Het
Krt75	T	C	15: 101,568,294	K387E	probably damaging	Het
Lum	A	T	10: 97,568,890	K216*	probably null	Het
Meioc	A	G	11: 102,674,953	N409S	probably benign	Het
Mrpl20	T	C	4: 155,803,945		probably null	Het
Naa16	A	T	14: 79,356,503	I374N	probably benign	Het
Nbea	A	G	3: 56,035,898	I652T	possibly damaging	Het
Nhsl1	G	A	10: 18,319,150	G56R	probably damaging	Het
Obscn	T	C	11: 59,082,824	I1894V	probably benign	Het
Olfr1288	T	C	2: 111,479,339	I185T	probably benign	Het
Olfr157	A	G	4: 43,835,765	S242P	probably benign	Het
Olfr510	T	A	7: 108,667,770	L118Q	probably damaging	Het
Olfr859	T	A	9: 19,809,233	V305D	possibly damaging	Het
Olig2	A	C	16: 91,226,886	T163P	probably damaging	Het
Parp4	G	A	14: 56,641,318		probably null	Het
Pcdhb2	T	C	18: 37,296,498	I508T	probably damaging	Het
Pcdhga8	T	C	18: 37,726,734	F281S	probably damaging	Het
Pom121l12	T	A	11: 14,599,516	M74K	possibly damaging	Het
Prpf8	T	C	11: 75,490,330	Y219H	possibly damaging	Het
Rhag	T	C	17: 40,831,657	V251A	possibly damaging	Het
Rrs1	A	G	1: 9,546,620	*366W	probably null	Het
Sgpp2	A	G	1: 78,390,506	D92G	probably damaging	Het
Slc44a3	C	A	3: 121,532,259		probably benign	Het
Smg8	T	C	11: 87,078,130	M257V	probably benign	Het
Taar7e	T	A	10: 24,038,051	Y146*	probably null	Het
Tet2	G	T	3: 133,487,142	N510K	possibly damaging	Het
Tgfbr3	T	C	5: 107,109,684	I836M	unknown	Het
Thada	A	G	17: 84,191,982	V1929A	probably benign	Het
Tram1l1	A	T	3: 124,322,250	D353V	probably damaging	Het
Trf	T	A	9: 103,217,535		probably null	Het
Trim15	A	T	17: 36,867,050	C18S	probably damaging	Het
Vmn1r62	T	C	7: 5,675,953	I211T	probably damaging	Het
Zdhhc17	A	G	10: 110,947,304	V501A	probably benign	Het
Zfp563	A	G	17: 33,105,454	E341G	probably benign	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTGGTCAATCTGCGGTGG -3'
(R):5'- TTGGCTACCCTGCAAAGCAAC -3'

Sequencing Primer
(F):5'- AACCGGAACcggctgcg -3'
(R):5'- AACCTCCCTGCCCGAGTC -3'

Posted On

2022-04-18