Incidental Mutation 'R9360:Btbd16'
ID 708632
Institutional Source Beutler Lab
Gene Symbol Btbd16
Ensembl Gene ENSMUSG00000040298
Gene Name BTB (POZ) domain containing 16
Synonyms E330040A16Rik
Accession Numbers

Genbank: NM_001081038.2; Ensembl: ENSMUST00000048453

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9360 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 130774069-130825899 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 130815786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 344 (R344C)
Ref Sequence ENSEMBL: ENSMUSP00000035433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048453] [ENSMUST00000124096] [ENSMUST00000207219] [ENSMUST00000208593]
AlphaFold E9Q173
Predicted Effect probably damaging
Transcript: ENSMUST00000048453
AA Change: R344C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035433
Gene: ENSMUSG00000040298
AA Change: R344C

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Blast:BTB 97 222 3e-47 BLAST
SCOP:d1buoa_ 154 218 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207219
Predicted Effect probably damaging
Transcript: ENSMUST00000208593
AA Change: R328C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a BTB/POZ domain. This domain mediates protein-protein interactions. A mutation in this gene may be associated with bipolar disorder. [provided by RefSeq, Sep 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Adam4 A G 12: 81,421,487 L120P probably damaging Het
Asb6 A G 2: 30,824,322 S259P probably damaging Het
Atp6v0a2 C A 5: 124,629,194 S7R possibly damaging Het
Cacna1h G A 17: 25,375,362 A2274V probably benign Het
Caml A C 13: 55,623,217 N43H probably damaging Het
Ccar2 A G 14: 70,141,996 S518P probably damaging Het
Cdkl3 A G 11: 52,033,522 I546V probably null Het
Chac1 C T 2: 119,352,373 T84I probably damaging Het
Col6a6 T C 9: 105,767,487 T1201A probably benign Het
Csf1 T C 3: 107,753,842 T120A possibly damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Cyp4f17 C T 17: 32,524,906 R353C probably benign Het
Depdc1a A G 3: 159,526,531 M640V possibly damaging Het
Dgkq A G 5: 108,650,603 V633A probably damaging Het
Fdft1 A T 14: 63,177,740 Y14* probably null Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gfm2 T A 13: 97,153,244 V179E probably damaging Het
Gm813 T C 16: 58,613,871 D161G probably benign Het
Gpr12 A G 5: 146,583,489 F208L probably benign Het
Greb1 A G 12: 16,740,036 S4P probably damaging Het
Hlcs A T 16: 94,131,813 I717N probably damaging Het
Hormad1 G A 3: 95,576,311 A145T probably benign Het
Kcmf1 A T 6: 72,861,843 C33* probably null Het
Kif13a A T 13: 46,808,996 S561T probably benign Het
Klhl20 G T 1: 161,093,699 P571Q probably benign Het
Kpna6 A T 4: 129,653,842 M304K probably benign Het
Krt75 T C 15: 101,568,294 K387E probably damaging Het
Lum A T 10: 97,568,890 K216* probably null Het
Meioc A G 11: 102,674,953 N409S probably benign Het
Mrpl20 T C 4: 155,803,945 probably null Het
Naa16 A T 14: 79,356,503 I374N probably benign Het
Nbea A G 3: 56,035,898 I652T possibly damaging Het
Nhsl1 G A 10: 18,319,150 G56R probably damaging Het
Obscn T C 11: 59,082,824 I1894V probably benign Het
Olfr1288 T C 2: 111,479,339 I185T probably benign Het
Olfr157 A G 4: 43,835,765 S242P probably benign Het
Olfr510 T A 7: 108,667,770 L118Q probably damaging Het
Olfr859 T A 9: 19,809,233 V305D possibly damaging Het
Olig2 A C 16: 91,226,886 T163P probably damaging Het
Parp4 G A 14: 56,641,318 probably null Het
Pcdhb2 T C 18: 37,296,498 I508T probably damaging Het
Pcdhga8 T C 18: 37,726,734 F281S probably damaging Het
Pom121l12 T A 11: 14,599,516 M74K possibly damaging Het
Prpf8 T C 11: 75,490,330 Y219H possibly damaging Het
Rhag T C 17: 40,831,657 V251A possibly damaging Het
Rrs1 A G 1: 9,546,620 *366W probably null Het
Sgpp2 A G 1: 78,390,506 D92G probably damaging Het
Slc44a3 C A 3: 121,532,259 probably benign Het
Smg8 T C 11: 87,078,130 M257V probably benign Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tet2 G T 3: 133,487,142 N510K possibly damaging Het
Tgfbr3 T C 5: 107,109,684 I836M unknown Het
Thada A G 17: 84,191,982 V1929A probably benign Het
Tram1l1 A T 3: 124,322,250 D353V probably damaging Het
Trf T A 9: 103,217,535 probably null Het
Trim15 A T 17: 36,867,050 C18S probably damaging Het
Vmn1r62 T C 7: 5,675,953 I211T probably damaging Het
Zdhhc17 A G 10: 110,947,304 V501A probably benign Het
Zfp563 A G 17: 33,105,454 E341G probably benign Het
Other mutations in Btbd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Btbd16 APN 7 130788822 missense probably damaging 1.00
IGL01020:Btbd16 APN 7 130824361 missense probably damaging 1.00
IGL01098:Btbd16 APN 7 130823245 missense probably damaging 1.00
IGL01412:Btbd16 APN 7 130805819 critical splice acceptor site probably null
1mM(1):Btbd16 UTSW 7 130821491 missense possibly damaging 0.86
R0063:Btbd16 UTSW 7 130823166 missense probably benign 0.25
R0063:Btbd16 UTSW 7 130823166 missense probably benign 0.25
R0147:Btbd16 UTSW 7 130779594 missense probably damaging 1.00
R0436:Btbd16 UTSW 7 130786053 missense probably benign 0.10
R0715:Btbd16 UTSW 7 130788827 missense probably damaging 1.00
R2127:Btbd16 UTSW 7 130784308 missense probably benign 0.17
R2411:Btbd16 UTSW 7 130790224 missense probably damaging 1.00
R3798:Btbd16 UTSW 7 130777140 missense probably benign 0.43
R5595:Btbd16 UTSW 7 130823303 missense possibly damaging 0.52
R5595:Btbd16 UTSW 7 130823304 missense probably damaging 1.00
R5839:Btbd16 UTSW 7 130815808 critical splice donor site probably null
R5933:Btbd16 UTSW 7 130784281 missense probably damaging 0.99
R6029:Btbd16 UTSW 7 130819072 missense probably benign 0.17
R7255:Btbd16 UTSW 7 130785992 missense probably benign 0.04
R7355:Btbd16 UTSW 7 130821443 missense probably benign 0.01
R7405:Btbd16 UTSW 7 130805856 missense probably benign 0.08
R7527:Btbd16 UTSW 7 130820472 missense probably damaging 1.00
R7980:Btbd16 UTSW 7 130824367 missense probably damaging 1.00
R8151:Btbd16 UTSW 7 130797095 missense probably damaging 1.00
R8429:Btbd16 UTSW 7 130795337 missense probably benign
R9142:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9143:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9161:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9214:Btbd16 UTSW 7 130779707 critical splice donor site probably null
R9266:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9267:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9269:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9362:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9392:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9418:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9420:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
R9431:Btbd16 UTSW 7 130815786 missense probably damaging 1.00
X0064:Btbd16 UTSW 7 130823170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACAACCACGCATTGCTTTG -3'
(R):5'- TCGCACTTCTTAGGCGTGAC -3'

Sequencing Primer
(F):5'- GCTGACCTGGATTTCACAAGC -3'
(R):5'- CTTCTTAGGCGTGACAATCTCAAGAG -3'
Posted On 2022-04-18