Incidental Mutation 'R0744:Tnfaip3'
Institutional Source Beutler Lab
Gene Symbol Tnfaip3
Ensembl Gene ENSMUSG00000019850
Gene Nametumor necrosis factor, alpha-induced protein 3
SynonymsA20, zinc finger protein A20, Tnfip3
MMRRC Submission 038925-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0744 (G1)
Quality Score225
Status Validated
Chromosomal Location19000910-19015657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19002949 bp
Amino Acid Change Alanine to Serine at position 704 (A704S)
Ref Sequence ENSEMBL: ENSMUSP00000101167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019997] [ENSMUST00000105527]
Predicted Effect probably benign
Transcript: ENSMUST00000019997
AA Change: A704S

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000019997
Gene: ENSMUSG00000019850
AA Change: A704S

Pfam:OTU 98 257 1.2e-30 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105527
AA Change: A704S

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101167
Gene: ENSMUSG00000019850
AA Change: A704S

Pfam:OTU 98 257 7.8e-34 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154749
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display runting, severe multi-organ inflammation, hypersensitivity to lipopolysaccharide and TNF, and premature death. Older mice homozygous for point mutations that disrupt deubiquitinating activity develop splenomegaly and show an increased number of myeloid cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aebp2 T G 6: 140,642,364 probably null Het
AI987944 T C 7: 41,376,859 Y6C probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Baiap2l1 T A 5: 144,266,641 D479V probably benign Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dzip3 A G 16: 48,959,675 Y301H probably damaging Het
Ephb4 T A 5: 137,365,667 N600K probably damaging Het
Erich6 T A 3: 58,636,122 probably benign Het
Fbn1 T C 2: 125,314,814 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Galnt17 T A 5: 131,150,916 D131V probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Gm6619 T A 6: 131,490,334 L54Q probably damaging Het
Herc2 T C 7: 56,206,036 probably benign Het
Hic1 T A 11: 75,165,801 Q754L possibly damaging Het
Hnf4g A T 3: 3,651,629 D286V possibly damaging Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc58 A G 16: 37,878,573 probably benign Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mark1 T A 1: 184,921,608 I166F probably damaging Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mast4 C G 13: 102,737,387 Q1632H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mgst3 A G 1: 167,373,805 Y104H probably damaging Het
Mlxipl C T 5: 135,132,475 T416I possibly damaging Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Muc1 C A 3: 89,230,328 P159Q possibly damaging Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Myt1 TGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGG 2: 181,797,505 probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr329-ps T A 11: 58,543,162 M105L possibly damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Pzp A G 6: 128,516,195 probably benign Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapgef3 G A 15: 97,761,585 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rgs11 T A 17: 26,203,318 M29K probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Slc6a13 T G 6: 121,302,867 W67G probably damaging Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Supt20 T A 3: 54,714,701 Y409N probably damaging Het
Synrg C T 11: 84,024,305 Q1046* probably null Het
Tab2 T C 10: 7,907,581 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm6 T C 2: 130,151,761 V640A probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tomm34 T C 2: 164,070,976 N22D probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Trim62 A G 4: 128,884,215 S16G probably damaging Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Ush2a C T 1: 188,814,406 probably benign Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zbed5 T A 5: 129,902,272 V354E possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Tnfaip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
lasvegas APN 10 19010758 unclassified probably benign
IGL00840:Tnfaip3 APN 10 19005126 missense probably damaging 1.00
IGL00966:Tnfaip3 APN 10 19005137 missense probably damaging 1.00
IGL01080:Tnfaip3 APN 10 19011655 missense probably benign 0.03
IGL01736:Tnfaip3 APN 10 19006901 missense probably damaging 1.00
IGL02318:Tnfaip3 APN 10 19004467 missense probably benign 0.04
IGL02703:Tnfaip3 APN 10 19007032 missense probably damaging 0.98
IGL03032:Tnfaip3 APN 10 19004609 missense probably benign
IGL03331:Tnfaip3 APN 10 19011601 missense possibly damaging 0.63
IGL03389:Tnfaip3 APN 10 19004987 missense probably benign 0.03
PIT4243001:Tnfaip3 UTSW 10 19011574 missense probably damaging 1.00
PIT4480001:Tnfaip3 UTSW 10 19007323 missense probably benign
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0056:Tnfaip3 UTSW 10 19005293 missense probably damaging 1.00
R0195:Tnfaip3 UTSW 10 19005713 missense probably damaging 1.00
R0226:Tnfaip3 UTSW 10 19002747 missense probably damaging 1.00
R0369:Tnfaip3 UTSW 10 19006912 nonsense probably null
R0833:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1876:Tnfaip3 UTSW 10 19004934 missense possibly damaging 0.81
R1902:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1903:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1922:Tnfaip3 UTSW 10 19003607 missense possibly damaging 0.51
R1973:Tnfaip3 UTSW 10 19004504 missense probably damaging 0.98
R2040:Tnfaip3 UTSW 10 19008152 missense possibly damaging 0.89
R2513:Tnfaip3 UTSW 10 19005659 missense probably benign 0.00
R2936:Tnfaip3 UTSW 10 19011609 missense probably damaging 1.00
R3607:Tnfaip3 UTSW 10 19005602 missense probably damaging 1.00
R4386:Tnfaip3 UTSW 10 19007010 missense probably damaging 1.00
R4483:Tnfaip3 UTSW 10 19011627 missense probably damaging 1.00
R4673:Tnfaip3 UTSW 10 19011832 intron probably benign
R4879:Tnfaip3 UTSW 10 19005573 missense probably benign 0.03
R5082:Tnfaip3 UTSW 10 19005284 missense probably damaging 1.00
R5524:Tnfaip3 UTSW 10 19008195 missense probably damaging 0.98
R6559:Tnfaip3 UTSW 10 19007248 missense probably damaging 1.00
R6776:Tnfaip3 UTSW 10 19005576 missense probably benign 0.02
R6853:Tnfaip3 UTSW 10 19003751 missense probably benign
R6891:Tnfaip3 UTSW 10 19011669 missense probably damaging 1.00
R7144:Tnfaip3 UTSW 10 19007281 missense probably benign 0.00
R7693:Tnfaip3 UTSW 10 19004780 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-09-30