Mutagenetix > Incidental Mutation

Incidental Mutation 'R9360:Naa16'

708655

Institutional Source

Beutler Lab

Gene Symbol

Naa16

Ensembl Gene

ENSMUSG00000022020

Gene Name

N(alpha)-acetyltransferase 16, NatA auxiliary subunit

Synonyms

Narg1l, 1300019C06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R9360 (G1)

Quality Score

187.009

Status

Not validated

Chromosome

Chromosomal Location

79325269-79390778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79356503 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 374 (I374N)

Ref Sequence

ENSEMBL: ENSMUSP00000022597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022597] [ENSMUST00000163486]

AlphaFold

Q9DBB4

Predicted Effect

probably benign
Transcript: ENSMUST00000022597
AA Change: I374N

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: I374N

Domain	Start	End	E-Value	Type
TPR	46	79	2.99e1	SMART
TPR	80	113	2.98e-3	SMART
Blast:TPR	224	257	1e-10	BLAST
TPR	374	407	9.96e0	SMART
TPR	408	441	7.47e0	SMART
low complexity region	616	633	N/A	INTRINSIC
Blast:TPR	672	705	3e-12	BLAST
low complexity region	830	841	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163486
AA Change: I340N

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000131268
Gene: ENSMUSG00000022020
AA Change: I340N

Domain	Start	End	E-Value	Type
TPR	12	45	2.99e1	SMART
TPR	46	79	2.98e-3	SMART
Blast:TPR	190	223	3e-10	BLAST
TPR	340	373	9.96e0	SMART
TPR	374	407	7.47e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430089I19Rik	G	T	5: 94,303,142	P375H	probably damaging	Het
Adam4	A	G	12: 81,421,487	L120P	probably damaging	Het
Asb6	A	G	2: 30,824,322	S259P	probably damaging	Het
Atp6v0a2	C	A	5: 124,629,194	S7R	possibly damaging	Het
Btbd16	C	T	7: 130,815,786	R344C	probably damaging	Het
Cacna1h	G	A	17: 25,375,362	A2274V	probably benign	Het
Caml	A	C	13: 55,623,217	N43H	probably damaging	Het
Ccar2	A	G	14: 70,141,996	S518P	probably damaging	Het
Cdkl3	A	G	11: 52,033,522	I546V	probably null	Het
Chac1	C	T	2: 119,352,373	T84I	probably damaging	Het
Col6a6	T	C	9: 105,767,487	T1201A	probably benign	Het
Csf1	T	C	3: 107,753,842	T120A	possibly damaging	Het
Ctsj	T	A	13: 61,003,820	I95F	probably benign	Het
Cyp4f17	C	T	17: 32,524,906	R353C	probably benign	Het
Depdc1a	A	G	3: 159,526,531	M640V	possibly damaging	Het
Dgkq	A	G	5: 108,650,603	V633A	probably damaging	Het
Fdft1	A	T	14: 63,177,740	Y14*	probably null	Het
Fktn	G	A	4: 53,734,854	G125D	probably benign	Het
Gfm2	T	A	13: 97,153,244	V179E	probably damaging	Het
Gm813	T	C	16: 58,613,871	D161G	probably benign	Het
Gpr12	A	G	5: 146,583,489	F208L	probably benign	Het
Greb1	A	G	12: 16,740,036	S4P	probably damaging	Het
Hlcs	A	T	16: 94,131,813	I717N	probably damaging	Het
Hormad1	G	A	3: 95,576,311	A145T	probably benign	Het
Kcmf1	A	T	6: 72,861,843	C33*	probably null	Het
Kif13a	A	T	13: 46,808,996	S561T	probably benign	Het
Klhl20	G	T	1: 161,093,699	P571Q	probably benign	Het
Kpna6	A	T	4: 129,653,842	M304K	probably benign	Het
Krt75	T	C	15: 101,568,294	K387E	probably damaging	Het
Lum	A	T	10: 97,568,890	K216*	probably null	Het
Meioc	A	G	11: 102,674,953	N409S	probably benign	Het
Mrpl20	T	C	4: 155,803,945		probably null	Het
Nbea	A	G	3: 56,035,898	I652T	possibly damaging	Het
Nhsl1	G	A	10: 18,319,150	G56R	probably damaging	Het
Obscn	T	C	11: 59,082,824	I1894V	probably benign	Het
Olfr1288	T	C	2: 111,479,339	I185T	probably benign	Het
Olfr157	A	G	4: 43,835,765	S242P	probably benign	Het
Olfr510	T	A	7: 108,667,770	L118Q	probably damaging	Het
Olfr859	T	A	9: 19,809,233	V305D	possibly damaging	Het
Olig2	A	C	16: 91,226,886	T163P	probably damaging	Het
Parp4	G	A	14: 56,641,318		probably null	Het
Pcdhb2	T	C	18: 37,296,498	I508T	probably damaging	Het
Pcdhga8	T	C	18: 37,726,734	F281S	probably damaging	Het
Pom121l12	T	A	11: 14,599,516	M74K	possibly damaging	Het
Prpf8	T	C	11: 75,490,330	Y219H	possibly damaging	Het
Rhag	T	C	17: 40,831,657	V251A	possibly damaging	Het
Rrs1	A	G	1: 9,546,620	*366W	probably null	Het
Sgpp2	A	G	1: 78,390,506	D92G	probably damaging	Het
Slc44a3	C	A	3: 121,532,259		probably benign	Het
Smg8	T	C	11: 87,078,130	M257V	probably benign	Het
Taar7e	T	A	10: 24,038,051	Y146*	probably null	Het
Tet2	G	T	3: 133,487,142	N510K	possibly damaging	Het
Tgfbr3	T	C	5: 107,109,684	I836M	unknown	Het
Thada	A	G	17: 84,191,982	V1929A	probably benign	Het
Tram1l1	A	T	3: 124,322,250	D353V	probably damaging	Het
Trf	T	A	9: 103,217,535		probably null	Het
Trim15	A	T	17: 36,867,050	C18S	probably damaging	Het
Vmn1r62	T	C	7: 5,675,953	I211T	probably damaging	Het
Zdhhc17	A	G	10: 110,947,304	V501A	probably benign	Het
Zfp563	A	G	17: 33,105,454	E341G	probably benign	Het

Other mutations in Naa16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Naa16	APN	14	79355729	missense	probably damaging	1.00
IGL01025:Naa16	APN	14	79384756	missense	probably damaging	1.00
IGL01155:Naa16	APN	14	79384715	missense	probably damaging	0.98
IGL01335:Naa16	APN	14	79345116	splice site	probably benign
IGL01981:Naa16	APN	14	79381516	missense	probably benign	0.05
IGL02230:Naa16	APN	14	79377361	splice site	probably benign
IGL02313:Naa16	APN	14	79384668	missense	probably damaging	1.00
IGL02418:Naa16	APN	14	79383366	missense	probably damaging	1.00
IGL02544:Naa16	APN	14	79335820	missense	probably damaging	1.00
IGL03051:Naa16	APN	14	79369082	missense	probably benign	0.01
IGL03064:Naa16	APN	14	79339628	missense	probably damaging	0.98
IGL03205:Naa16	APN	14	79356512	missense	possibly damaging	0.89
PIT4508001:Naa16	UTSW	14	79369087	missense	probably benign	0.15
R0651:Naa16	UTSW	14	79351392	missense	probably damaging	1.00
R1429:Naa16	UTSW	14	79359527	missense	probably benign	0.01
R1674:Naa16	UTSW	14	79387057	start codon destroyed	probably null	0.65
R1693:Naa16	UTSW	14	79351456	missense	probably damaging	1.00
R1874:Naa16	UTSW	14	79355743	missense	possibly damaging	0.62
R1992:Naa16	UTSW	14	79356491	missense	probably damaging	1.00
R2015:Naa16	UTSW	14	79345059	missense	probably damaging	1.00
R2391:Naa16	UTSW	14	79370049	missense	probably benign	0.16
R2847:Naa16	UTSW	14	79335883	missense	probably damaging	1.00
R2848:Naa16	UTSW	14	79335883	missense	probably damaging	1.00
R2877:Naa16	UTSW	14	79343298	missense	probably benign	0.00
R3884:Naa16	UTSW	14	79343262	missense	probably damaging	0.98
R4001:Naa16	UTSW	14	79343121	splice site	probably null
R4199:Naa16	UTSW	14	79355871	missense	probably damaging	1.00
R4638:Naa16	UTSW	14	79340033	splice site	probably null
R4676:Naa16	UTSW	14	79336348	unclassified	probably benign
R4690:Naa16	UTSW	14	79345057	missense	probably damaging	1.00
R4952:Naa16	UTSW	14	79345085	missense	probably damaging	1.00
R5087:Naa16	UTSW	14	79377415	missense	possibly damaging	0.68
R5104:Naa16	UTSW	14	79384700	nonsense	probably null
R5729:Naa16	UTSW	14	79355780	missense	probably damaging	1.00
R6178:Naa16	UTSW	14	79383340	missense	possibly damaging	0.93
R6960:Naa16	UTSW	14	79359471	missense	possibly damaging	0.65
R7794:Naa16	UTSW	14	79377494	missense	probably damaging	1.00
R7936:Naa16	UTSW	14	79341046	missense	possibly damaging	0.47
R8356:Naa16	UTSW	14	79359475	missense	probably benign	0.00
R8456:Naa16	UTSW	14	79359475	missense	probably benign	0.00
R8892:Naa16	UTSW	14	79390576	missense	probably benign	0.32
R8931:Naa16	UTSW	14	79344955	missense	probably damaging	1.00
R9010:Naa16	UTSW	14	79370042	missense	probably benign	0.01
R9068:Naa16	UTSW	14	79374849	missense	probably benign	0.18
R9688:Naa16	UTSW	14	79335869	nonsense	probably null
X0064:Naa16	UTSW	14	79351389	missense	probably damaging	1.00
Z1177:Naa16	UTSW	14	79344979	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGACCCAGTTCCTGCTACC -3'
(R):5'- AGTCATACCTCTTCCTGTTGAGAC -3'

Sequencing Primer
(F):5'- TCCAGAGGTCCTGAGTTCAAATC -3'
(R):5'- GTTGAGACTGATCATTTTTGCTAAGC -3'

Posted On

2022-04-18