Incidental Mutation 'R9361:St5'
ID 708696
Institutional Source Beutler Lab
Gene Symbol St5
Ensembl Gene ENSMUSG00000031024
Gene Name suppression of tumorigenicity 5
Synonyms 2610305K15Rik, 2010004M01Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R9361 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109523911-109703605 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109527784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 907 (S907P)
Ref Sequence ENSEMBL: ENSMUSP00000077067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005]
AlphaFold Q924W7
Predicted Effect probably damaging
Transcript: ENSMUST00000077909
AA Change: S907P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: S907P

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079282
AA Change: S907P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: S907P

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084738
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: S490P

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168005
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: S490P

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik C T 8: 120,634,321 A12T unknown Het
2810474O19Rik T G 6: 149,326,634 S393A possibly damaging Het
4933402N22Rik C T 5: 11,920,679 T105M Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Aasdh T A 5: 76,882,378 T792S probably benign Het
Actl11 T A 9: 107,928,625 L49Q probably damaging Het
Adcy3 G T 12: 4,209,366 R881L possibly damaging Het
Alox15 T G 11: 70,350,853 K67N probably damaging Het
Amotl1 C T 9: 14,593,381 R177Q probably benign Het
Ankrd34c T A 9: 89,730,130 I53F probably damaging Het
Atp8b5 T A 4: 43,369,658 F932Y possibly damaging Het
Bckdk A G 7: 127,907,343 M281V probably benign Het
Ccdc33 C T 9: 58,117,625 C106Y possibly damaging Het
Celsr3 T A 9: 108,849,322 I3250N probably damaging Het
Ces1g A T 8: 93,335,018 probably null Het
Ces2b G A 8: 104,837,407 probably null Het
Clspn A T 4: 126,585,861 D1033V probably damaging Het
Cntln G T 4: 85,049,914 R790I probably benign Het
Cspg4 T C 9: 56,896,593 V1656A probably damaging Het
Dlgap1 A T 17: 70,761,264 D610V probably damaging Het
Eya4 C A 10: 23,109,867 G579W probably damaging Het
Fam46b G T 4: 133,486,150 A111S probably damaging Het
Fam83b T C 9: 76,492,794 I342M probably benign Het
Fhdc1 A C 3: 84,448,833 C435G probably damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Fras1 T G 5: 96,776,698 L3666R probably damaging Het
Gm11639 C T 11: 105,005,698 T4291I probably benign Het
Gm21560 T A 14: 6,218,262 H72L possibly damaging Het
Gtsf2 C T 15: 103,439,639 W148* probably null Het
Gucy2c T C 6: 136,737,431 K466E possibly damaging Het
Higd2a T A 13: 54,590,307 D14E probably benign Het
Hlcs C T 16: 94,138,940 V513M probably benign Het
Ido1 T C 8: 24,589,585 T148A probably benign Het
Ighv1-5 T A 12: 114,513,365 T106S probably damaging Het
Igkv4-92 T C 6: 68,755,106 T95A possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Larp4b T G 13: 9,149,901 F278V probably damaging Het
Lrch4 G A 5: 137,636,814 R225H probably damaging Het
Mapkbp1 T C 2: 120,014,771 Y378H probably benign Het
Nme9 T A 9: 99,459,722 C42S probably damaging Het
Olfr1380 A G 11: 49,564,476 K185R probably damaging Het
Pdlim2 T G 14: 70,164,741 T309P probably damaging Het
Prodh C T 16: 18,080,970 C207Y probably benign Het
Prom1 A T 5: 44,055,887 L168Q probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Shkbp1 T C 7: 27,352,067 Q189R probably benign Het
Skint4 T C 4: 112,143,824 L372S probably damaging Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Specc1 A T 11: 62,146,318 E699D probably benign Het
Syt6 C A 3: 103,575,363 probably benign Het
Tg A G 15: 66,685,397 E969G possibly damaging Het
Tie1 A C 4: 118,479,632 H632Q probably benign Het
Trappc12 A G 12: 28,746,418 W372R probably damaging Het
Trav7d-4 T C 14: 52,770,149 V33A probably damaging Het
Ugdh A T 5: 65,418,543 N324K probably damaging Het
Vmn2r79 G T 7: 87,003,614 probably null Het
Washc2 T C 6: 116,262,472 *1335Q probably null Het
Yme1l1 C T 2: 23,191,051 T445I possibly damaging Het
Zdhhc11 T C 13: 73,974,618 C158R probably damaging Het
Zfp128 T C 7: 12,890,437 L244P probably damaging Het
Zfp445 T A 9: 122,861,822 I103F probably damaging Het
Zfp980 A T 4: 145,701,429 T243S probably benign Het
Other mutations in St5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:St5 APN 7 109527708 missense possibly damaging 0.71
IGL01132:St5 APN 7 109570005 splice site probably null
IGL01288:St5 APN 7 109539822 missense probably damaging 0.96
IGL01645:St5 APN 7 109527634 nonsense probably null
IGL01714:St5 APN 7 109570062 missense probably damaging 0.99
IGL02021:St5 APN 7 109557372 missense probably damaging 1.00
IGL02302:St5 APN 7 109525331 missense probably damaging 1.00
IGL02496:St5 APN 7 109556235 missense possibly damaging 0.83
IGL02795:St5 APN 7 109556364 missense probably damaging 1.00
Bucolic UTSW 7 109525548 nonsense probably null
Halcyon UTSW 7 109556793 nonsense probably null
FR4340:St5 UTSW 7 109556921 unclassified probably benign
FR4737:St5 UTSW 7 109556921 unclassified probably benign
PIT4466001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4469001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4472001:St5 UTSW 7 109531130 missense probably damaging 1.00
R0024:St5 UTSW 7 109524659 missense probably damaging 1.00
R0124:St5 UTSW 7 109542511 missense possibly damaging 0.66
R0125:St5 UTSW 7 109556338 missense probably benign 0.19
R0365:St5 UTSW 7 109538949 missense probably damaging 1.00
R0491:St5 UTSW 7 109557204 missense probably benign 0.45
R0534:St5 UTSW 7 109541428 missense probably damaging 1.00
R0662:St5 UTSW 7 109557426 missense probably damaging 1.00
R0743:St5 UTSW 7 109557345 missense probably damaging 1.00
R0772:St5 UTSW 7 109542320 splice site probably null
R0774:St5 UTSW 7 109542320 splice site probably null
R0787:St5 UTSW 7 109525620 missense possibly damaging 0.94
R0884:St5 UTSW 7 109557345 missense probably damaging 1.00
R1518:St5 UTSW 7 109557355 missense probably damaging 1.00
R1908:St5 UTSW 7 109525326 nonsense probably null
R1909:St5 UTSW 7 109525326 nonsense probably null
R2232:St5 UTSW 7 109557207 missense probably benign
R2358:St5 UTSW 7 109556446 missense probably benign 0.01
R2847:St5 UTSW 7 109525337 missense probably damaging 1.00
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2873:St5 UTSW 7 109557430 missense probably benign 0.01
R2874:St5 UTSW 7 109557430 missense probably benign 0.01
R4534:St5 UTSW 7 109531156 missense probably damaging 1.00
R4536:St5 UTSW 7 109531156 missense probably damaging 1.00
R4559:St5 UTSW 7 109525578 missense probably damaging 1.00
R4798:St5 UTSW 7 109557033 missense probably damaging 0.99
R4846:St5 UTSW 7 109556836 nonsense probably null
R5110:St5 UTSW 7 109542490 missense probably benign 0.02
R5181:St5 UTSW 7 109556790 missense probably benign
R5268:St5 UTSW 7 109557312 missense probably benign
R5403:St5 UTSW 7 109556905 missense probably damaging 1.00
R5836:St5 UTSW 7 109541345 missense possibly damaging 0.78
R5932:St5 UTSW 7 109570016 missense probably damaging 1.00
R5937:St5 UTSW 7 109557271 missense possibly damaging 0.86
R6180:St5 UTSW 7 109556888 missense probably benign 0.11
R6741:St5 UTSW 7 109545097 missense possibly damaging 0.95
R6781:St5 UTSW 7 109525304 missense possibly damaging 0.83
R7086:St5 UTSW 7 109525574 missense probably damaging 1.00
R7466:St5 UTSW 7 109525346 missense probably damaging 1.00
R7644:St5 UTSW 7 109556793 nonsense probably null
R8354:St5 UTSW 7 109525548 nonsense probably null
R8745:St5 UTSW 7 109557072 missense probably benign 0.02
R8859:St5 UTSW 7 109524656 missense probably damaging 1.00
R9016:St5 UTSW 7 109540435 missense possibly damaging 0.84
R9178:St5 UTSW 7 109557084 missense probably benign 0.31
R9564:St5 UTSW 7 109526329 missense probably damaging 1.00
R9595:St5 UTSW 7 109556766 missense probably damaging 0.96
RF062:St5 UTSW 7 109556946 unclassified probably benign
X0067:St5 UTSW 7 109556240 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGATCCCCACAGCCTTTC -3'
(R):5'- TATGTCACAGTGTGCTGAGTAC -3'

Sequencing Primer
(F):5'- GGGCGGCTTACCTCTTCCAC -3'
(R):5'- GTCACAGTGTGCTGAGTACATACC -3'
Posted On 2022-04-18