Mutagenetix > Incidental Mutation

Incidental Mutation 'R9361:St5'

708696

Institutional Source

Beutler Lab

Gene Symbol

St5

Ensembl Gene

ENSMUSG00000031024

Gene Name

suppression of tumorigenicity 5

Synonyms

2610305K15Rik, 2010004M01Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.430) question?

Stock #

R9361 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

109523911-109703605 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 109527784 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 907 (S907P)

Ref Sequence

ENSEMBL: ENSMUSP00000077067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005]

AlphaFold

Q924W7

Predicted Effect

probably damaging
Transcript: ENSMUST00000077909
AA Change: S907P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: S907P

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000079282
AA Change: S907P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: S907P

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000084738
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: S490P

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168005
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: S490P

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190005I06Rik	C	T	8: 120,634,321	A12T	unknown	Het
2810474O19Rik	T	G	6: 149,326,634	S393A	possibly damaging	Het
4933402N22Rik	C	T	5: 11,920,679	T105M		Het
A430089I19Rik	G	T	5: 94,303,142	P375H	probably damaging	Het
Aasdh	T	A	5: 76,882,378	T792S	probably benign	Het
Actl11	T	A	9: 107,928,625	L49Q	probably damaging	Het
Adcy3	G	T	12: 4,209,366	R881L	possibly damaging	Het
Alox15	T	G	11: 70,350,853	K67N	probably damaging	Het
Amotl1	C	T	9: 14,593,381	R177Q	probably benign	Het
Ankrd34c	T	A	9: 89,730,130	I53F	probably damaging	Het
Atp8b5	T	A	4: 43,369,658	F932Y	possibly damaging	Het
Bckdk	A	G	7: 127,907,343	M281V	probably benign	Het
Ccdc33	C	T	9: 58,117,625	C106Y	possibly damaging	Het
Celsr3	T	A	9: 108,849,322	I3250N	probably damaging	Het
Ces1g	A	T	8: 93,335,018		probably null	Het
Ces2b	G	A	8: 104,837,407		probably null	Het
Clspn	A	T	4: 126,585,861	D1033V	probably damaging	Het
Cntln	G	T	4: 85,049,914	R790I	probably benign	Het
Cspg4	T	C	9: 56,896,593	V1656A	probably damaging	Het
Dlgap1	A	T	17: 70,761,264	D610V	probably damaging	Het
Eya4	C	A	10: 23,109,867	G579W	probably damaging	Het
Fam46b	G	T	4: 133,486,150	A111S	probably damaging	Het
Fam83b	T	C	9: 76,492,794	I342M	probably benign	Het
Fhdc1	A	C	3: 84,448,833	C435G	probably damaging	Het
Fktn	G	A	4: 53,734,854	G125D	probably benign	Het
Fras1	T	G	5: 96,776,698	L3666R	probably damaging	Het
Gm11639	C	T	11: 105,005,698	T4291I	probably benign	Het
Gm21560	T	A	14: 6,218,262	H72L	possibly damaging	Het
Gtsf2	C	T	15: 103,439,639	W148*	probably null	Het
Gucy2c	T	C	6: 136,737,431	K466E	possibly damaging	Het
Higd2a	T	A	13: 54,590,307	D14E	probably benign	Het
Hlcs	C	T	16: 94,138,940	V513M	probably benign	Het
Ido1	T	C	8: 24,589,585	T148A	probably benign	Het
Ighv1-5	T	A	12: 114,513,365	T106S	probably damaging	Het
Igkv4-92	T	C	6: 68,755,106	T95A	possibly damaging	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Larp4b	T	G	13: 9,149,901	F278V	probably damaging	Het
Lrch4	G	A	5: 137,636,814	R225H	probably damaging	Het
Mapkbp1	T	C	2: 120,014,771	Y378H	probably benign	Het
Nme9	T	A	9: 99,459,722	C42S	probably damaging	Het
Olfr1380	A	G	11: 49,564,476	K185R	probably damaging	Het
Pdlim2	T	G	14: 70,164,741	T309P	probably damaging	Het
Prodh	C	T	16: 18,080,970	C207Y	probably benign	Het
Prom1	A	T	5: 44,055,887	L168Q	probably damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Shkbp1	T	C	7: 27,352,067	Q189R	probably benign	Het
Skint4	T	C	4: 112,143,824	L372S	probably damaging	Het
Slc4a11	C	T	2: 130,691,744	A100T	probably damaging	Het
Specc1	A	T	11: 62,146,318	E699D	probably benign	Het
Syt6	C	A	3: 103,575,363		probably benign	Het
Tg	A	G	15: 66,685,397	E969G	possibly damaging	Het
Tie1	A	C	4: 118,479,632	H632Q	probably benign	Het
Trappc12	A	G	12: 28,746,418	W372R	probably damaging	Het
Trav7d-4	T	C	14: 52,770,149	V33A	probably damaging	Het
Ugdh	A	T	5: 65,418,543	N324K	probably damaging	Het
Vmn2r79	G	T	7: 87,003,614		probably null	Het
Washc2	T	C	6: 116,262,472	*1335Q	probably null	Het
Yme1l1	C	T	2: 23,191,051	T445I	possibly damaging	Het
Zdhhc11	T	C	13: 73,974,618	C158R	probably damaging	Het
Zfp128	T	C	7: 12,890,437	L244P	probably damaging	Het
Zfp445	T	A	9: 122,861,822	I103F	probably damaging	Het
Zfp980	A	T	4: 145,701,429	T243S	probably benign	Het

Other mutations in St5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:St5	APN	7	109527708	missense	possibly damaging	0.71
IGL01132:St5	APN	7	109570005	splice site	probably null
IGL01288:St5	APN	7	109539822	missense	probably damaging	0.96
IGL01645:St5	APN	7	109527634	nonsense	probably null
IGL01714:St5	APN	7	109570062	missense	probably damaging	0.99
IGL02021:St5	APN	7	109557372	missense	probably damaging	1.00
IGL02302:St5	APN	7	109525331	missense	probably damaging	1.00
IGL02496:St5	APN	7	109556235	missense	possibly damaging	0.83
IGL02795:St5	APN	7	109556364	missense	probably damaging	1.00
Bucolic	UTSW	7	109525548	nonsense	probably null
Halcyon	UTSW	7	109556793	nonsense	probably null
FR4340:St5	UTSW	7	109556921	unclassified	probably benign
FR4737:St5	UTSW	7	109556921	unclassified	probably benign
PIT4466001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4469001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4472001:St5	UTSW	7	109531130	missense	probably damaging	1.00
R0024:St5	UTSW	7	109524659	missense	probably damaging	1.00
R0124:St5	UTSW	7	109542511	missense	possibly damaging	0.66
R0125:St5	UTSW	7	109556338	missense	probably benign	0.19
R0365:St5	UTSW	7	109538949	missense	probably damaging	1.00
R0491:St5	UTSW	7	109557204	missense	probably benign	0.45
R0534:St5	UTSW	7	109541428	missense	probably damaging	1.00
R0662:St5	UTSW	7	109557426	missense	probably damaging	1.00
R0743:St5	UTSW	7	109557345	missense	probably damaging	1.00
R0772:St5	UTSW	7	109542320	splice site	probably null
R0774:St5	UTSW	7	109542320	splice site	probably null
R0787:St5	UTSW	7	109525620	missense	possibly damaging	0.94
R0884:St5	UTSW	7	109557345	missense	probably damaging	1.00
R1518:St5	UTSW	7	109557355	missense	probably damaging	1.00
R1908:St5	UTSW	7	109525326	nonsense	probably null
R1909:St5	UTSW	7	109525326	nonsense	probably null
R2232:St5	UTSW	7	109557207	missense	probably benign
R2358:St5	UTSW	7	109556446	missense	probably benign	0.01
R2847:St5	UTSW	7	109525337	missense	probably damaging	1.00
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2873:St5	UTSW	7	109557430	missense	probably benign	0.01
R2874:St5	UTSW	7	109557430	missense	probably benign	0.01
R4534:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4536:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4559:St5	UTSW	7	109525578	missense	probably damaging	1.00
R4798:St5	UTSW	7	109557033	missense	probably damaging	0.99
R4846:St5	UTSW	7	109556836	nonsense	probably null
R5110:St5	UTSW	7	109542490	missense	probably benign	0.02
R5181:St5	UTSW	7	109556790	missense	probably benign
R5268:St5	UTSW	7	109557312	missense	probably benign
R5403:St5	UTSW	7	109556905	missense	probably damaging	1.00
R5836:St5	UTSW	7	109541345	missense	possibly damaging	0.78
R5932:St5	UTSW	7	109570016	missense	probably damaging	1.00
R5937:St5	UTSW	7	109557271	missense	possibly damaging	0.86
R6180:St5	UTSW	7	109556888	missense	probably benign	0.11
R6741:St5	UTSW	7	109545097	missense	possibly damaging	0.95
R6781:St5	UTSW	7	109525304	missense	possibly damaging	0.83
R7086:St5	UTSW	7	109525574	missense	probably damaging	1.00
R7466:St5	UTSW	7	109525346	missense	probably damaging	1.00
R7644:St5	UTSW	7	109556793	nonsense	probably null
R8354:St5	UTSW	7	109525548	nonsense	probably null
R8745:St5	UTSW	7	109557072	missense	probably benign	0.02
R8859:St5	UTSW	7	109524656	missense	probably damaging	1.00
R9016:St5	UTSW	7	109540435	missense	possibly damaging	0.84
R9178:St5	UTSW	7	109557084	missense	probably benign	0.31
R9564:St5	UTSW	7	109526329	missense	probably damaging	1.00
R9595:St5	UTSW	7	109556766	missense	probably damaging	0.96
RF062:St5	UTSW	7	109556946	unclassified	probably benign
X0067:St5	UTSW	7	109556240	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGATGATCCCCACAGCCTTTC -3'
(R):5'- TATGTCACAGTGTGCTGAGTAC -3'

Sequencing Primer
(F):5'- GGGCGGCTTACCTCTTCCAC -3'
(R):5'- GTCACAGTGTGCTGAGTACATACC -3'

Posted On

2022-04-18