Mutagenetix > Incidental Mutation

Incidental Mutation 'R9362:Igf2r'

708768

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R9362 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12722175 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 473 (I473N)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably benign
Transcript: ENSMUST00000024599
AA Change: I473N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: I473N

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430089I19Rik	G	T	5: 94,303,142 (GRCm38)	P375H	probably damaging	Het
Adamts20	T	A	15: 94,338,745 (GRCm38)	N798I	possibly damaging	Het
Ahdc1	G	A	4: 133,063,037 (GRCm38)	V530I	probably benign	Het
Arhgef17	A	C	7: 100,930,958 (GRCm38)	L261R	probably benign	Het
Bcr	C	A	10: 75,157,191 (GRCm38)	N839K	probably benign	Het
Bltp1	A	G	3: 36,957,013 (GRCm38)	T1786A	probably benign	Het
Bmpr1a	A	G	14: 34,434,403 (GRCm38)	I169T	probably benign	Het
Btbd16	C	T	7: 130,815,786 (GRCm38)	R344C	probably damaging	Het
Ccdc88a	T	A	11: 29,503,922 (GRCm38)	L1695Q	probably null	Het
Cnr1	T	C	4: 33,944,038 (GRCm38)	I142T	probably damaging	Het
Col15a1	G	C	4: 47,288,200 (GRCm38)		probably benign	Het
Elmod1	T	A	9: 53,926,020 (GRCm38)	D167V	possibly damaging	Het
Fam136a	C	T	6: 86,368,873 (GRCm38)	T124I	possibly damaging	Het
Galnt13	A	G	2: 54,733,052 (GRCm38)	D70G	probably benign	Het
Ggcx	T	G	6: 72,428,032 (GRCm38)	N474K	probably damaging	Het
Gm10295	C	A	7: 71,351,007 (GRCm38)		probably benign	Het
Gm5145	A	G	17: 20,571,080 (GRCm38)	H240R	probably damaging	Het
Gsr	A	T	8: 33,689,378 (GRCm38)	D338V	probably damaging	Het
Hcfc2	C	T	10: 82,738,424 (GRCm38)	P144L	probably damaging	Het
Ighv5-8	A	T	12: 113,653,320 (GRCm38)	D107E	probably benign	Het
Il23r	T	A	6: 67,423,400 (GRCm38)	S649C	probably damaging	Het
Ltbp3	A	G	19: 5,753,669 (GRCm38)	D794G	probably benign	Het
Mapk3	A	G	7: 126,764,272 (GRCm38)	I273V		Het
Mycbp2	C	T	14: 103,260,206 (GRCm38)	V977I	probably damaging	Het
Myh7	A	G	14: 54,985,475 (GRCm38)	F758L	probably benign	Het
Myom1	A	T	17: 71,036,293 (GRCm38)	I162F	probably benign	Het
Ncor2	C	T	5: 125,018,201 (GRCm38)	C1541Y		Het
Nwd2	G	T	5: 63,804,404 (GRCm38)	D444Y	probably benign	Het
Obsl1	A	G	1: 75,505,747 (GRCm38)	Y160H	probably benign	Het
Or8u8	C	A	2: 86,181,388 (GRCm38)	C241F	probably damaging	Het
Sall2	T	A	14: 52,313,144 (GRCm38)	K865*	probably null	Het
Shank2	A	T	7: 144,409,534 (GRCm38)	D293V	probably damaging	Het
Sidt1	T	C	16: 44,257,953 (GRCm38)	Y649C	possibly damaging	Het
Slc11a2	T	C	15: 100,406,355 (GRCm38)	E154G	probably damaging	Het
Slc5a12	C	T	2: 110,616,699 (GRCm38)	T184I	probably damaging	Het
Slfn3	T	C	11: 83,212,981 (GRCm38)	I226T	probably benign	Het
Snapc4	T	A	2: 26,364,853 (GRCm38)	N1220Y	probably damaging	Het
Tars1	A	G	15: 11,387,530 (GRCm38)	C557R	probably damaging	Het
Tead2	A	G	7: 45,232,316 (GRCm38)	E402G	probably damaging	Het
Zfp37	G	A	4: 62,192,062 (GRCm38)	S296F	probably benign	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,713,990 (GRCm38)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,739,328 (GRCm38)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,700,358 (GRCm38)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,683,867 (GRCm38)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,704,775 (GRCm38)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,695,374 (GRCm38)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,704,349 (GRCm38)	missense	probably benign
IGL01557:Igf2r	APN	17	12,704,635 (GRCm38)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,683,985 (GRCm38)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,725,415 (GRCm38)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,701,313 (GRCm38)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,683,822 (GRCm38)	missense	probably benign
IGL01839:Igf2r	APN	17	12,705,022 (GRCm38)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,714,911 (GRCm38)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,704,338 (GRCm38)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,693,192 (GRCm38)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,702,005 (GRCm38)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,698,516 (GRCm38)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,748,763 (GRCm38)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,712,087 (GRCm38)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,719,883 (GRCm38)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,692,723 (GRCm38)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,694,120 (GRCm38)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,710,746 (GRCm38)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,726,676 (GRCm38)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,716,672 (GRCm38)	missense	probably damaging	1.00
blunt	UTSW	17	12,722,175 (GRCm38)	missense	probably benign	0.02
brusque	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
gruff	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
outlier	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,691,962 (GRCm38)	missense	probably benign
R0165:Igf2r	UTSW	17	12,698,527 (GRCm38)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,683,948 (GRCm38)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,692,064 (GRCm38)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,717,274 (GRCm38)	splice site	probably null
R0722:Igf2r	UTSW	17	12,715,495 (GRCm38)	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12,692,101 (GRCm38)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,694,124 (GRCm38)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,717,269 (GRCm38)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,691,285 (GRCm38)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,726,309 (GRCm38)	missense	probably benign
R1693:Igf2r	UTSW	17	12,704,316 (GRCm38)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,697,441 (GRCm38)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,704,270 (GRCm38)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,733,903 (GRCm38)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,692,738 (GRCm38)	missense	probably benign
R2060:Igf2r	UTSW	17	12,701,319 (GRCm38)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,698,251 (GRCm38)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,722,208 (GRCm38)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,715,943 (GRCm38)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,722,311 (GRCm38)	splice site	probably null
R2696:Igf2r	UTSW	17	12,695,344 (GRCm38)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,709,468 (GRCm38)	missense	probably benign
R3930:Igf2r	UTSW	17	12,705,829 (GRCm38)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,748,751 (GRCm38)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,702,254 (GRCm38)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,703,465 (GRCm38)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,684,126 (GRCm38)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12,701,353 (GRCm38)	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12,691,877 (GRCm38)	splice site	probably null
R4980:Igf2r	UTSW	17	12,703,360 (GRCm38)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,725,416 (GRCm38)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,693,145 (GRCm38)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,739,334 (GRCm38)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,717,367 (GRCm38)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,698,352 (GRCm38)	splice site	probably null
R5794:Igf2r	UTSW	17	12,709,445 (GRCm38)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,714,113 (GRCm38)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,683,900 (GRCm38)	missense	probably benign
R6396:Igf2r	UTSW	17	12,714,090 (GRCm38)	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12,701,250 (GRCm38)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6591:Igf2r	UTSW	17	12,689,008 (GRCm38)	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12,698,618 (GRCm38)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,689,008 (GRCm38)	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12,714,944 (GRCm38)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,714,082 (GRCm38)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,703,376 (GRCm38)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,697,341 (GRCm38)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,718,718 (GRCm38)	missense	probably benign
R7030:Igf2r	UTSW	17	12,733,866 (GRCm38)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,698,325 (GRCm38)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,704,323 (GRCm38)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,714,116 (GRCm38)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,703,484 (GRCm38)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,698,228 (GRCm38)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,710,645 (GRCm38)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,698,273 (GRCm38)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,735,991 (GRCm38)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,739,369 (GRCm38)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,748,704 (GRCm38)	missense	probably benign
R8022:Igf2r	UTSW	17	12,718,795 (GRCm38)	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12,701,238 (GRCm38)	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12,692,071 (GRCm38)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,733,860 (GRCm38)	missense	probably benign
R8359:Igf2r	UTSW	17	12,683,861 (GRCm38)	missense	probably benign
R8500:Igf2r	UTSW	17	12,709,441 (GRCm38)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,704,313 (GRCm38)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,704,637 (GRCm38)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,701,244 (GRCm38)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,726,772 (GRCm38)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,716,650 (GRCm38)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,751,293 (GRCm38)	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12,691,213 (GRCm38)	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12,739,351 (GRCm38)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,695,353 (GRCm38)	missense	probably damaging	1.00
R9371:Igf2r	UTSW	17	12,705,759 (GRCm38)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,698,328 (GRCm38)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,686,754 (GRCm38)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,694,140 (GRCm38)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,726,701 (GRCm38)	missense	probably benign
X0028:Igf2r	UTSW	17	12,704,913 (GRCm38)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,697,399 (GRCm38)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCAAGTAGTTCACCTCCTAAC -3'
(R):5'- CTCTGGACAGCTAGGTGATTCC -3'

Sequencing Primer
(F):5'- GCAAGTAGTTCACCTCCTAACTAGTG -3'
(R):5'- CCTGGGTGTGGGTCATGTCAC -3'

Posted On

2022-04-18