Incidental Mutation 'R9363:Polr3a'
ID 708795
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9363 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24500831 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1319 (A1319V)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: A1319V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: A1319V

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,438,575 (GRCm39) probably null Het
Alkbh1 A T 12: 87,487,080 (GRCm39) Y96* probably null Het
Alkbh8 T A 9: 3,385,576 (GRCm39) C658S probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Blm T C 7: 80,108,663 (GRCm39) Y1327C probably damaging Het
Ccdc28a C T 10: 18,094,050 (GRCm39) D190N unknown Het
Chdh A G 14: 29,753,310 (GRCm39) E73G probably damaging Het
Dab2 C T 15: 6,460,481 (GRCm39) P463L probably benign Het
Dcun1d2 A G 8: 13,309,014 (GRCm39) Y184H probably benign Het
Dst T C 1: 34,235,060 (GRCm39) L3535P probably damaging Het
Egr3 A G 14: 70,316,761 (GRCm39) I153V possibly damaging Het
Fktn G A 4: 53,734,854 (GRCm39) G125D probably benign Het
Hcfc2 C T 10: 82,574,258 (GRCm39) P144L probably damaging Het
Jkampl T A 6: 73,446,487 (GRCm39) I21F possibly damaging Het
Mdc1 C A 17: 36,162,019 (GRCm39) Q942K probably benign Het
Med15 C T 16: 17,489,414 (GRCm39) V387I unknown Het
Muc4 C T 16: 32,576,992 (GRCm39) S94L Het
Or5ak23 T A 2: 85,244,993 (GRCm39) I77F probably damaging Het
Otud3 G T 4: 138,623,133 (GRCm39) N369K probably benign Het
Parp14 C T 16: 35,678,586 (GRCm39) E461K possibly damaging Het
Paxbp1 T A 16: 90,827,395 (GRCm39) Q480L probably damaging Het
Pramel39-ps G T 5: 94,451,001 (GRCm39) P375H probably damaging Het
Prkg2 A T 5: 99,172,257 (GRCm39) S153T probably benign Het
Scara3 T C 14: 66,168,720 (GRCm39) D299G probably benign Het
Scube1 C A 15: 83,499,080 (GRCm39) E712* probably null Het
Setd4 T A 16: 93,388,009 (GRCm39) E159V probably benign Het
Slc15a2 T A 16: 36,572,672 (GRCm39) I670F possibly damaging Het
Slc4a11 C T 2: 130,533,664 (GRCm39) A100T probably damaging Het
Smok2b G A 17: 13,453,637 (GRCm39) probably null Het
Snx18 G A 13: 113,754,732 (GRCm39) P67L probably benign Het
St3gal5 A T 6: 72,119,301 (GRCm39) K165* probably null Het
Sun5 A G 2: 153,700,365 (GRCm39) I294T probably benign Het
Svil A G 18: 5,037,155 (GRCm39) K37E probably benign Het
Tmem104 T C 11: 115,134,691 (GRCm39) I409T probably benign Het
Tnxb T C 17: 34,917,294 (GRCm39) Y2230H possibly damaging Het
Trps1 A G 15: 50,524,676 (GRCm39) S1085P probably damaging Het
Ttn A T 2: 76,612,592 (GRCm39) N17162K probably damaging Het
Ugt1a7c T A 1: 88,023,616 (GRCm39) F258L probably damaging Het
Vmn2r102 C T 17: 19,897,614 (GRCm39) H210Y probably benign Het
Vmn2r75 A T 7: 85,815,423 (GRCm39) V147E probably benign Het
Zhx3 G A 2: 160,621,785 (GRCm39) A794V probably benign Het
Zscan2 A G 7: 80,525,331 (GRCm39) T351A probably benign Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0817:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R2363:Polr3a UTSW 14 24,525,960 (GRCm39) splice site probably null
R3419:Polr3a UTSW 14 24,517,103 (GRCm39) missense probably damaging 1.00
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5232:Polr3a UTSW 14 24,503,279 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R8848:Polr3a UTSW 14 24,500,834 (GRCm39) missense probably damaging 1.00
R9025:Polr3a UTSW 14 24,519,479 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9309:Polr3a UTSW 14 24,510,067 (GRCm39) missense probably benign
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACATGTAGGTCAGTGGGGC -3'
(R):5'- TATTCCTTGAGTAGCTGCATGGC -3'

Sequencing Primer
(F):5'- TTCAAGGACTCAGGAGCCATAGATTC -3'
(R):5'- AGTAGCTGCATGGCTGGTTTTG -3'
Posted On 2022-04-18