Mutagenetix > Incidental Mutation

Incidental Mutation 'R0744:Rictor'

70882

Institutional Source

Beutler Lab

Gene Symbol

Rictor

Ensembl Gene

ENSMUSG00000050310

Gene Name

RPTOR independent companion of MTOR, complex 2

Synonyms

D530039E11Rik, 4921505C17Rik, 6030405M08Rik

MMRRC Submission

038925-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0744 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6708379-6800401 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 6764278 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000051809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061656]

AlphaFold

Q6QI06

Predicted Effect

probably null
Transcript: ENSMUST00000061656

SMART Domains

Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310

Domain	Start	End	E-Value	Type
RICTOR_N	57	439	4.02e-185	SMART
RICTOR_M	523	742	5.66e-98	SMART
RasGEF_N_2	743	857	1.26e-54	SMART
RICTOR_V	920	992	1.44e-40	SMART
low complexity region	1019	1043	N/A	INTRINSIC
RICTOR_phospho	1084	1189	4.06e-58	SMART
low complexity region	1221	1239	N/A	INTRINSIC
low complexity region	1255	1266	N/A	INTRINSIC
low complexity region	1273	1287	N/A	INTRINSIC
low complexity region	1404	1414	N/A	INTRINSIC
low complexity region	1464	1474	N/A	INTRINSIC
low complexity region	1616	1628	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226181

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228266

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228918

Meta Mutation Damage Score

0.9484

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

98% (91/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,165,069	L41P	probably damaging	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aebp2	T	G	6: 140,642,364		probably null	Het
AI987944	T	C	7: 41,376,859	Y6C	probably damaging	Het
Ascc3	T	C	10: 50,845,666	W2072R	probably benign	Het
Asxl3	A	G	18: 22,516,040	D362G	probably damaging	Het
Baiap2l1	T	A	5: 144,266,641	D479V	probably benign	Het
Bdp1	A	T	13: 100,035,825	H2094Q	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Cd226	A	C	18: 89,207,020		probably benign	Het
Clip1	T	C	5: 123,630,721	D605G	probably benign	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dzip3	A	G	16: 48,959,675	Y301H	probably damaging	Het
Ephb4	T	A	5: 137,365,667	N600K	probably damaging	Het
Erich6	T	A	3: 58,636,122		probably benign	Het
Fbn1	T	C	2: 125,314,814		probably benign	Het
Fryl	A	T	5: 73,089,081		probably benign	Het
Galnt17	T	A	5: 131,150,916	D131V	probably damaging	Het
Gm13089	A	T	4: 143,698,486	M129K	probably benign	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Gm6619	T	A	6: 131,490,334	L54Q	probably damaging	Het
Herc2	T	C	7: 56,206,036		probably benign	Het
Hic1	T	A	11: 75,165,801	Q754L	possibly damaging	Het
Hnf4g	A	T	3: 3,651,629	D286V	possibly damaging	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itih1	A	T	14: 30,941,555	V164E	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Lrfn5	A	C	12: 61,839,668	T81P	probably damaging	Het
Lrrc58	A	G	16: 37,878,573		probably benign	Het
March6	T	C	15: 31,480,291	Y562C	probably benign	Het
Mark1	T	A	1: 184,921,608	I166F	probably damaging	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mast4	C	G	13: 102,737,387	Q1632H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mgst3	A	G	1: 167,373,805	Y104H	probably damaging	Het
Mlxipl	C	T	5: 135,132,475	T416I	possibly damaging	Het
Mthfd2l	T	C	5: 90,946,942	V90A	probably damaging	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Muc1	C	A	3: 89,230,328	P159Q	possibly damaging	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Myt1	TGAGGAGGAGGAGGAGGAGG	TGAGGAGGAGGAGGAGG	2: 181,797,505		probably benign	Het
Olfr1513	T	C	14: 52,349,378	I223V	probably benign	Het
Olfr329-ps	T	A	11: 58,543,162	M105L	possibly damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Pdcd6	A	G	13: 74,316,324		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Pzp	A	G	6: 128,516,195		probably benign	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapgef3	G	A	15: 97,761,585		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rgs11	T	A	17: 26,203,318	M29K	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Samd9l	T	C	6: 3,372,725	E1512G	possibly damaging	Het
Sgsm1	C	T	5: 113,279,184	A127T	probably benign	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc26a1	T	A	5: 108,673,523	T167S	probably benign	Het
Slc2a12	T	C	10: 22,702,016		probably benign	Het
Slc44a5	T	C	3: 154,265,474	S654P	probably damaging	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Slc6a13	T	G	6: 121,302,867	W67G	probably damaging	Het
Sowahc	GGGAGGAGGAGGAGGAGGAGGAGGAGGA	GGGAGGAGGAGGAGGAGGAGGAGGA	10: 59,223,491		probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Supt20	T	A	3: 54,714,701	Y409N	probably damaging	Het
Synrg	C	T	11: 84,024,305	Q1046*	probably null	Het
Tab2	T	C	10: 7,907,581		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm6	T	C	2: 130,151,761	V640A	probably benign	Het
Tle2	T	C	10: 81,588,947	F667L	probably damaging	Het
Tnfaip3	C	A	10: 19,002,949	A704S	probably benign	Het
Tomm34	T	C	2: 164,070,976	N22D	probably benign	Het
Trabd2b	A	G	4: 114,580,322	Q232R	probably benign	Het
Trim62	A	G	4: 128,884,215	S16G	probably damaging	Het
Ttc28	T	A	5: 111,231,081	I1144N	probably damaging	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Ush2a	C	T	1: 188,814,406		probably benign	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zbed5	T	A	5: 129,902,272	V354E	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Rictor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Rictor	APN	15	6786590	missense	probably damaging	0.99
IGL00785:Rictor	APN	15	6776950	missense	probably damaging	1.00
IGL00801:Rictor	APN	15	6794534	missense	probably damaging	1.00
IGL01072:Rictor	APN	15	6789562	missense	probably damaging	0.98
IGL01139:Rictor	APN	15	6778268	missense	probably damaging	1.00
IGL01303:Rictor	APN	15	6708638	missense	probably benign	0.10
IGL01307:Rictor	APN	15	6774604	splice site	probably null
IGL01767:Rictor	APN	15	6777384	missense	probably damaging	1.00
IGL01774:Rictor	APN	15	6769777	missense	probably damaging	1.00
IGL01800:Rictor	APN	15	6774701	missense	probably damaging	0.99
IGL02192:Rictor	APN	15	6786414	missense	probably benign	0.00
IGL02503:Rictor	APN	15	6786443	missense	probably benign	0.06
IGL02652:Rictor	APN	15	6776187	critical splice donor site	probably null
IGL02656:Rictor	APN	15	6776920	missense	probably damaging	0.98
IGL02752:Rictor	APN	15	6787371	missense	probably benign	0.02
IGL03000:Rictor	APN	15	6769240	splice site	probably benign
IGL03118:Rictor	APN	15	6759518	missense	possibly damaging	0.93
IGL03182:Rictor	APN	15	6789598	missense	probably benign	0.08
Tense	UTSW	15	6759496	missense	possibly damaging	0.94
Tonus	UTSW	15	6769334	critical splice donor site	probably null
Torrid	UTSW	15	6759572	missense	probably damaging	1.00
R0149:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0288:Rictor	UTSW	15	6786540	missense	probably benign	0.08
R0304:Rictor	UTSW	15	6786371	splice site	probably null
R0336:Rictor	UTSW	15	6776753	critical splice acceptor site	probably null
R0361:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0423:Rictor	UTSW	15	6773900	missense	possibly damaging	0.77
R0453:Rictor	UTSW	15	6708642	missense	probably benign	0.01
R0515:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R0630:Rictor	UTSW	15	6794492	missense	probably damaging	1.00
R0730:Rictor	UTSW	15	6773986	splice site	probably benign
R0836:Rictor	UTSW	15	6764278	critical splice acceptor site	probably null
R0881:Rictor	UTSW	15	6791670	missense	probably benign
R1114:Rictor	UTSW	15	6794005	nonsense	probably null
R1367:Rictor	UTSW	15	6790638	splice site	probably benign
R1655:Rictor	UTSW	15	6772212	missense	probably benign	0.00
R1678:Rictor	UTSW	15	6756471	missense	probably benign	0.07
R1679:Rictor	UTSW	15	6768090	missense	possibly damaging	0.92
R1754:Rictor	UTSW	15	6735368	missense	probably damaging	1.00
R1757:Rictor	UTSW	15	6773862	missense	possibly damaging	0.95
R1762:Rictor	UTSW	15	6756573	missense	probably benign	0.00
R1914:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1915:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1994:Rictor	UTSW	15	6776156	missense	probably benign	0.18
R2145:Rictor	UTSW	15	6765107	missense	probably damaging	1.00
R2182:Rictor	UTSW	15	6772204	missense	probably damaging	0.96
R2191:Rictor	UTSW	15	6759614	missense	probably benign	0.04
R2357:Rictor	UTSW	15	6783562	missense	probably damaging	0.99
R2914:Rictor	UTSW	15	6769995	critical splice donor site	probably null
R3082:Rictor	UTSW	15	6774857	missense	probably benign	0.15
R3885:Rictor	UTSW	15	6759610	missense	probably damaging	1.00
R3900:Rictor	UTSW	15	6789473	missense	probably benign	0.01
R4376:Rictor	UTSW	15	6786967	missense	probably benign	0.00
R4611:Rictor	UTSW	15	6787144	missense	possibly damaging	0.75
R4644:Rictor	UTSW	15	6777935	nonsense	probably null
R4718:Rictor	UTSW	15	6783160	missense	possibly damaging	0.81
R4822:Rictor	UTSW	15	6791680	missense	probably benign	0.01
R4980:Rictor	UTSW	15	6781660	missense	probably damaging	1.00
R5034:Rictor	UTSW	15	6768095	missense	probably damaging	0.98
R5179:Rictor	UTSW	15	6795940	missense	probably damaging	1.00
R5386:Rictor	UTSW	15	6789504	missense	probably benign	0.37
R5532:Rictor	UTSW	15	6789565	missense	probably damaging	1.00
R5549:Rictor	UTSW	15	6786910	missense	probably damaging	1.00
R5715:Rictor	UTSW	15	6750716	nonsense	probably null
R5733:Rictor	UTSW	15	6783104	missense	probably benign
R5822:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5848:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5849:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5850:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5854:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5855:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5856:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5936:Rictor	UTSW	15	6784161	missense	probably damaging	0.99
R6155:Rictor	UTSW	15	6793977	missense	probably benign	0.44
R6394:Rictor	UTSW	15	6769309	missense	possibly damaging	0.59
R6549:Rictor	UTSW	15	6796175	missense	probably damaging	1.00
R6611:Rictor	UTSW	15	6750659	missense	probably damaging	1.00
R6657:Rictor	UTSW	15	6759496	missense	possibly damaging	0.94
R6705:Rictor	UTSW	15	6794012	missense	probably benign	0.00
R6819:Rictor	UTSW	15	6796036	critical splice donor site	probably null
R6985:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R6989:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7016:Rictor	UTSW	15	6774880	critical splice donor site	probably null
R7030:Rictor	UTSW	15	6708453	critical splice donor site	probably null
R7066:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7067:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7216:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R7396:Rictor	UTSW	15	6786981	missense	not run
R7449:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7450:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7452:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7616:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7620:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7643:Rictor	UTSW	15	6769269	nonsense	probably null
R7699:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7700:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7749:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7750:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7751:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7753:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7841:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7894:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7897:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7898:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7937:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7944:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8062:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8063:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8094:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8119:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8134:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8166:Rictor	UTSW	15	6769334	critical splice donor site	probably null
R8324:Rictor	UTSW	15	6745562	missense	probably damaging	1.00
R8343:Rictor	UTSW	15	6778319	critical splice donor site	probably null
R8691:Rictor	UTSW	15	6787032	missense	probably damaging	1.00
R8859:Rictor	UTSW	15	6783586	missense	probably damaging	0.98
R8953:Rictor	UTSW	15	6794447	missense	probably benign	0.39
R8977:Rictor	UTSW	15	6783085	missense	probably benign
R9008:Rictor	UTSW	15	6772129	splice site	probably benign
R9369:Rictor	UTSW	15	6744367	missense	probably benign	0.00
R9563:Rictor	UTSW	15	6768081	missense	possibly damaging	0.83
R9695:Rictor	UTSW	15	6786529	missense	probably benign	0.00
X0020:Rictor	UTSW	15	6756482	missense	probably benign	0.32
X0060:Rictor	UTSW	15	6786552	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCCAGAAGCGCCTTTATGCCC -3'
(R):5'- TGCTATGTACAACTGAGCCACGAAC -3'

Sequencing Primer
(F):5'- GCGCCTTTATGCCCATGTC -3'
(R):5'- CAAGGCCATCTCCTCCCG -3'

Posted On

2013-09-30