Mutagenetix > Incidental Mutation

Incidental Mutation 'R9364:Mast3'

708846

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9364 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70786182 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 493 (V493M)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: V509M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V509M

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: V493M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
Ankrd17	C	T	5: 90,268,649	R1108Q	probably damaging	Het
Ccdc136	C	T	6: 29,405,961	A102V	probably damaging	Het
Ccnyl1	A	G	1: 64,714,591	Y187C	probably damaging	Het
Copa	G	A	1: 172,117,264	V882I	probably benign	Het
Cyp17a1	C	T	19: 46,668,726	R361H	probably damaging	Het
Ddx49	T	C	8: 70,293,576	T459A	probably benign	Het
Depdc5	A	G	5: 32,964,732	N1133S	probably benign	Het
Dnajc18	T	C	18: 35,675,207	D329G	probably damaging	Het
Dusp16	G	A	6: 134,719,019	P283L	probably damaging	Het
Efcab12	A	G	6: 115,838,014	V40A	probably benign	Het
Emb	G	T	13: 117,220,560		probably benign	Het
Fam120b	G	A	17: 15,405,758	A458T	possibly damaging	Het
Fgd4	G	A	16: 16,490,489	T9I	probably benign	Het
Hivep1	G	A	13: 42,154,775	D164N	possibly damaging	Het
Klf13	T	A	7: 63,924,861		probably benign	Het
Lrrc47	T	C	4: 154,015,941	S325P	possibly damaging	Het
Med22	T	C	2: 26,905,809	T200A	probably benign	Het
Mettl15	T	A	2: 109,131,615	Q216H	probably benign	Het
Mmel1	A	G	4: 154,892,510	D561G	probably null	Het
Ms4a4a	G	A	19: 11,390,344	M191I	probably benign	Het
Myh11	T	A	16: 14,200,716	N1922I		Het
Myo7b	T	C	18: 32,000,360	I371V	probably benign	Het
Myo9b	T	C	8: 71,355,839	S1697P	probably damaging	Het
Neurod4	T	C	10: 130,270,971	T145A	probably benign	Het
Nfx1	T	C	4: 41,023,756	V1055A	probably benign	Het
Ntng1	C	T	3: 110,135,364	A49T	probably damaging	Het
Oc90	G	A	15: 65,889,588	P194S	probably benign	Het
Olfr1087	A	T	2: 86,690,231	V248D	possibly damaging	Het
Olfr1375	T	A	11: 51,048,396	Y96*	probably null	Het
Olfr169	T	A	16: 19,565,972	I304F	possibly damaging	Het
Olfr446	T	A	6: 42,927,600	I123N	probably damaging	Het
Opcml	A	C	9: 28,903,328	N292T	probably damaging	Het
Oplah	A	G	15: 76,309,587	S57P	probably benign	Het
Pdzd8	A	T	19: 59,345,142	L149Q	probably damaging	Het
Pid1	A	G	1: 84,159,311	V33A	probably benign	Het
Prpsap1	A	G	11: 116,494,189		probably benign	Het
R3hdml	T	C	2: 163,492,615	W42R	probably benign	Het
Rnase6	A	T	14: 51,130,405	N85Y	possibly damaging	Het
Scn3a	T	A	2: 65,461,252	M1717L	possibly damaging	Het
Setbp1	C	T	18: 78,783,384	S1338N	probably benign	Het
Sh2b2	T	C	5: 136,224,152	T389A	probably benign	Het
Sh2d4a	G	A	8: 68,294,366	G82D	probably damaging	Het
Skint9	A	T	4: 112,391,718	M171K	probably benign	Het
Slc5a11	C	T	7: 123,269,101	R505W	probably damaging	Het
Slx4	C	A	16: 3,987,956	M577I	probably benign	Het
Soga3	G	A	10: 29,196,779	R689Q	probably damaging	Het
Tarbp1	C	T	8: 126,450,723	V737I	probably benign	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem100	A	T	11: 90,035,707	E120V	probably damaging	Het
Trim72	C	T	7: 128,010,001	T325M	possibly damaging	Het
Trpc2	G	A	7: 102,090,612	G581D	possibly damaging	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Ubn1	T	C	16: 5,070,628	S154P	unknown	Het
Uchl1	T	A	5: 66,676,306	M6K	probably damaging	Het
Vmn1r193	A	T	13: 22,219,819	M1K	probably null	Het
Wisp1	G	A	15: 66,913,051	R191K	probably benign	Het
Zfp429	T	A	13: 67,390,412	K304N	probably benign	Het
Zfp618	A	G	4: 63,118,587	N375D	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp78	A	T	7: 6,379,355	D468V	probably benign	Het
Zfp809	A	C	9: 22,239,098	Y297S	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTTCCACCCTAAAGGCAGAG -3'
(R):5'- TCTTAGAATGCTACCCTGCTGG -3'

Sequencing Primer
(F):5'- CAGAGCAGGTGCATGTGTG -3'
(R):5'- TGCTGGGCAGAACCTATAGACC -3'

Posted On

2022-04-18