Incidental Mutation 'R9364:Setbp1'
ID 708873
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene Name SET binding protein 1
Synonyms Seb
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.596) question?
Stock # R9364 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 78793595-79152606 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78826599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 1338 (S1338N)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
AlphaFold Q9Z180
Predicted Effect probably benign
Transcript: ENSMUST00000025430
AA Change: S1338N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: S1338N

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Ankrd17 C T 5: 90,416,508 (GRCm39) R1108Q probably damaging Het
Ccdc136 C T 6: 29,405,960 (GRCm39) A102V probably damaging Het
Ccn4 G A 15: 66,784,900 (GRCm39) R191K probably benign Het
Ccnyl1 A G 1: 64,753,750 (GRCm39) Y187C probably damaging Het
Copa G A 1: 171,944,831 (GRCm39) V882I probably benign Het
Cyp17a1 C T 19: 46,657,165 (GRCm39) R361H probably damaging Het
Ddx49 T C 8: 70,746,226 (GRCm39) T459A probably benign Het
Depdc5 A G 5: 33,122,076 (GRCm39) N1133S probably benign Het
Dnajc18 T C 18: 35,808,260 (GRCm39) D329G probably damaging Het
Dusp16 G A 6: 134,695,982 (GRCm39) P283L probably damaging Het
Efcab12 A G 6: 115,814,975 (GRCm39) V40A probably benign Het
Emb G T 13: 117,357,096 (GRCm39) probably benign Het
Fam120b G A 17: 15,626,020 (GRCm39) A458T possibly damaging Het
Fgd4 G A 16: 16,308,353 (GRCm39) T9I probably benign Het
Hivep1 G A 13: 42,308,251 (GRCm39) D164N possibly damaging Het
Klf13 T A 7: 63,574,609 (GRCm39) probably benign Het
Lrrc47 T C 4: 154,100,398 (GRCm39) S325P possibly damaging Het
Mast3 C T 8: 71,238,826 (GRCm39) V493M probably damaging Het
Med22 T C 2: 26,795,821 (GRCm39) T200A probably benign Het
Mettl15 T A 2: 108,961,960 (GRCm39) Q216H probably benign Het
Mmel1 A G 4: 154,976,967 (GRCm39) D561G probably null Het
Ms4a4a G A 19: 11,367,708 (GRCm39) M191I probably benign Het
Mtcl3 G A 10: 29,072,775 (GRCm39) R689Q probably damaging Het
Myh11 T A 16: 14,018,580 (GRCm39) N1922I Het
Myo7b T C 18: 32,133,413 (GRCm39) I371V probably benign Het
Myo9b T C 8: 71,808,483 (GRCm39) S1697P probably damaging Het
Neurod4 T C 10: 130,106,840 (GRCm39) T145A probably benign Het
Nfx1 T C 4: 41,023,756 (GRCm39) V1055A probably benign Het
Ntng1 C T 3: 110,042,680 (GRCm39) A49T probably damaging Het
Oc90 G A 15: 65,761,437 (GRCm39) P194S probably benign Het
Opcml A C 9: 28,814,624 (GRCm39) N292T probably damaging Het
Oplah A G 15: 76,193,787 (GRCm39) S57P probably benign Het
Or1x6 T A 11: 50,939,223 (GRCm39) Y96* probably null Het
Or2a12 T A 6: 42,904,534 (GRCm39) I123N probably damaging Het
Or2aj4 T A 16: 19,384,722 (GRCm39) I304F possibly damaging Het
Or8k3b A T 2: 86,520,575 (GRCm39) V248D possibly damaging Het
Pdzd8 A T 19: 59,333,574 (GRCm39) L149Q probably damaging Het
Pid1 A G 1: 84,137,032 (GRCm39) V33A probably benign Het
Prpsap1 A G 11: 116,385,015 (GRCm39) probably benign Het
R3hdml T C 2: 163,334,535 (GRCm39) W42R probably benign Het
Rnase6 A T 14: 51,367,862 (GRCm39) N85Y possibly damaging Het
Scn3a T A 2: 65,291,596 (GRCm39) M1717L possibly damaging Het
Sh2b2 T C 5: 136,253,006 (GRCm39) T389A probably benign Het
Sh2d4a G A 8: 68,747,018 (GRCm39) G82D probably damaging Het
Skint9 A T 4: 112,248,915 (GRCm39) M171K probably benign Het
Slc5a11 C T 7: 122,868,324 (GRCm39) R505W probably damaging Het
Slx4 C A 16: 3,805,820 (GRCm39) M577I probably benign Het
Tarbp1 C T 8: 127,177,462 (GRCm39) V737I probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem100 A T 11: 89,926,533 (GRCm39) E120V probably damaging Het
Trim72 C T 7: 127,609,173 (GRCm39) T325M possibly damaging Het
Trpc2 G A 7: 101,739,819 (GRCm39) G581D possibly damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Ubn1 T C 16: 4,888,492 (GRCm39) S154P unknown Het
Uchl1 T A 5: 66,833,649 (GRCm39) M6K probably damaging Het
Vmn1r193 A T 13: 22,403,989 (GRCm39) M1K probably null Het
Zfp429 T A 13: 67,538,531 (GRCm39) K304N probably benign Het
Zfp618 A G 4: 63,036,824 (GRCm39) N375D probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp78 A T 7: 6,382,354 (GRCm39) D468V probably benign Het
Zfp809 A C 9: 22,150,394 (GRCm39) Y297S probably damaging Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78,798,894 (GRCm39) nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78,900,985 (GRCm39) missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78,899,992 (GRCm39) missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78,900,625 (GRCm39) missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78,900,514 (GRCm39) missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78,900,688 (GRCm39) missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78,798,925 (GRCm39) missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78,900,589 (GRCm39) nonsense probably null
IGL03005:Setbp1 APN 18 78,902,340 (GRCm39) missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78,900,224 (GRCm39) missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78,900,841 (GRCm39) missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78,901,075 (GRCm39) missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78,900,451 (GRCm39) missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78,899,798 (GRCm39) missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78,901,423 (GRCm39) missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78,826,573 (GRCm39) missense probably benign 0.00
R1481:Setbp1 UTSW 18 78,826,516 (GRCm39) missense probably benign 0.01
R1482:Setbp1 UTSW 18 79,130,050 (GRCm39) missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78,903,127 (GRCm39) missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78,901,807 (GRCm39) missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78,901,682 (GRCm39) missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78,900,613 (GRCm39) missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78,901,577 (GRCm39) missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78,901,759 (GRCm39) missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78,899,935 (GRCm39) missense probably benign 0.00
R2851:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2853:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2941:Setbp1 UTSW 18 78,901,412 (GRCm39) missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78,900,650 (GRCm39) missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78,902,518 (GRCm39) missense probably benign 0.00
R3807:Setbp1 UTSW 18 78,826,537 (GRCm39) missense probably benign 0.01
R4133:Setbp1 UTSW 18 78,900,206 (GRCm39) missense probably benign 0.05
R4287:Setbp1 UTSW 18 78,902,276 (GRCm39) missense probably benign 0.03
R4345:Setbp1 UTSW 18 79,129,794 (GRCm39) missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78,899,833 (GRCm39) missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79,129,896 (GRCm39) missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79,130,164 (GRCm39) missense probably benign 0.00
R4595:Setbp1 UTSW 18 78,900,731 (GRCm39) missense probably benign 0.00
R4817:Setbp1 UTSW 18 78,902,015 (GRCm39) missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78,901,382 (GRCm39) missense probably benign 0.07
R4976:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78,899,809 (GRCm39) missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78,900,514 (GRCm39) missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78,900,697 (GRCm39) missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78,901,214 (GRCm39) missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78,900,190 (GRCm39) missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78,901,278 (GRCm39) missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79,129,867 (GRCm39) missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78,900,700 (GRCm39) missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78,899,860 (GRCm39) missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78,899,697 (GRCm39) splice site probably null
R5940:Setbp1 UTSW 18 78,798,703 (GRCm39) missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78,902,455 (GRCm39) missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6250:Setbp1 UTSW 18 78,901,217 (GRCm39) missense probably benign 0.00
R6256:Setbp1 UTSW 18 78,900,472 (GRCm39) missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78,826,584 (GRCm39) missense probably benign 0.21
R6522:Setbp1 UTSW 18 78,900,605 (GRCm39) missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78,902,774 (GRCm39) missense probably benign 0.00
R6886:Setbp1 UTSW 18 78,900,715 (GRCm39) missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78,901,054 (GRCm39) missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79,130,070 (GRCm39) missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79,130,175 (GRCm39) missense probably benign 0.08
R7134:Setbp1 UTSW 18 78,902,734 (GRCm39) missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78,900,052 (GRCm39) missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78,798,960 (GRCm39) missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78,900,701 (GRCm39) missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.06
R7589:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.01
R7840:Setbp1 UTSW 18 78,826,639 (GRCm39) missense probably benign 0.03
R7849:Setbp1 UTSW 18 78,900,068 (GRCm39) missense probably benign 0.00
R8147:Setbp1 UTSW 18 78,900,015 (GRCm39) missense probably damaging 1.00
R8354:Setbp1 UTSW 18 78,900,598 (GRCm39) missense probably damaging 1.00
R8446:Setbp1 UTSW 18 78,900,971 (GRCm39) missense probably damaging 1.00
R8524:Setbp1 UTSW 18 78,901,969 (GRCm39) missense probably damaging 1.00
R8534:Setbp1 UTSW 18 78,826,542 (GRCm39) missense possibly damaging 0.86
R8694:Setbp1 UTSW 18 78,901,516 (GRCm39) missense probably damaging 1.00
R8931:Setbp1 UTSW 18 78,899,723 (GRCm39) missense probably benign 0.00
R8983:Setbp1 UTSW 18 78,902,459 (GRCm39) missense probably benign 0.37
R9062:Setbp1 UTSW 18 78,900,266 (GRCm39) missense probably benign 0.01
R9113:Setbp1 UTSW 18 78,900,948 (GRCm39) missense probably damaging 0.99
R9513:Setbp1 UTSW 18 78,899,781 (GRCm39) missense probably damaging 1.00
R9517:Setbp1 UTSW 18 78,901,322 (GRCm39) missense probably damaging 0.99
R9549:Setbp1 UTSW 18 78,902,629 (GRCm39) missense probably benign 0.07
R9554:Setbp1 UTSW 18 78,826,599 (GRCm39) missense probably benign 0.00
R9680:Setbp1 UTSW 18 78,902,498 (GRCm39) missense probably benign
R9711:Setbp1 UTSW 18 78,900,142 (GRCm39) missense probably benign 0.30
Z1088:Setbp1 UTSW 18 78,902,809 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGACAGTTCCACAGACACCTAC -3'
(R):5'- CAACTTGCTGCACTGGAAGG -3'

Sequencing Primer
(F):5'- CCCCATGATGAGAGGACTTCTTAAG -3'
(R):5'- GAGGACAAACAGTTGGACTATTTAC -3'
Posted On 2022-04-18