Incidental Mutation 'R9364:Setbp1'
ID 708873
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene Name SET binding protein 1
Synonyms Seb
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock # R9364 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 78750380-79109391 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78783384 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 1338 (S1338N)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
AlphaFold Q9Z180
Predicted Effect probably benign
Transcript: ENSMUST00000025430
AA Change: S1338N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: S1338N

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Ccdc136 C T 6: 29,405,961 A102V probably damaging Het
Ccnyl1 A G 1: 64,714,591 Y187C probably damaging Het
Copa G A 1: 172,117,264 V882I probably benign Het
Cyp17a1 C T 19: 46,668,726 R361H probably damaging Het
Ddx49 T C 8: 70,293,576 T459A probably benign Het
Depdc5 A G 5: 32,964,732 N1133S probably benign Het
Dnajc18 T C 18: 35,675,207 D329G probably damaging Het
Dusp16 G A 6: 134,719,019 P283L probably damaging Het
Efcab12 A G 6: 115,838,014 V40A probably benign Het
Emb G T 13: 117,220,560 probably benign Het
Fam120b G A 17: 15,405,758 A458T possibly damaging Het
Fgd4 G A 16: 16,490,489 T9I probably benign Het
Hivep1 G A 13: 42,154,775 D164N possibly damaging Het
Klf13 T A 7: 63,924,861 probably benign Het
Lrrc47 T C 4: 154,015,941 S325P possibly damaging Het
Mast3 C T 8: 70,786,182 V493M probably damaging Het
Med22 T C 2: 26,905,809 T200A probably benign Het
Mettl15 T A 2: 109,131,615 Q216H probably benign Het
Mmel1 A G 4: 154,892,510 D561G probably null Het
Ms4a4a G A 19: 11,390,344 M191I probably benign Het
Myh11 T A 16: 14,200,716 N1922I Het
Myo7b T C 18: 32,000,360 I371V probably benign Het
Myo9b T C 8: 71,355,839 S1697P probably damaging Het
Neurod4 T C 10: 130,270,971 T145A probably benign Het
Nfx1 T C 4: 41,023,756 V1055A probably benign Het
Ntng1 C T 3: 110,135,364 A49T probably damaging Het
Oc90 G A 15: 65,889,588 P194S probably benign Het
Olfr1087 A T 2: 86,690,231 V248D possibly damaging Het
Olfr1375 T A 11: 51,048,396 Y96* probably null Het
Olfr169 T A 16: 19,565,972 I304F possibly damaging Het
Olfr446 T A 6: 42,927,600 I123N probably damaging Het
Opcml A C 9: 28,903,328 N292T probably damaging Het
Oplah A G 15: 76,309,587 S57P probably benign Het
Pdzd8 A T 19: 59,345,142 L149Q probably damaging Het
Pid1 A G 1: 84,159,311 V33A probably benign Het
Prpsap1 A G 11: 116,494,189 probably benign Het
R3hdml T C 2: 163,492,615 W42R probably benign Het
Rnase6 A T 14: 51,130,405 N85Y possibly damaging Het
Scn3a T A 2: 65,461,252 M1717L possibly damaging Het
Sh2b2 T C 5: 136,224,152 T389A probably benign Het
Sh2d4a G A 8: 68,294,366 G82D probably damaging Het
Skint9 A T 4: 112,391,718 M171K probably benign Het
Slc5a11 C T 7: 123,269,101 R505W probably damaging Het
Slx4 C A 16: 3,987,956 M577I probably benign Het
Soga3 G A 10: 29,196,779 R689Q probably damaging Het
Tarbp1 C T 8: 126,450,723 V737I probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem100 A T 11: 90,035,707 E120V probably damaging Het
Trim72 C T 7: 128,010,001 T325M possibly damaging Het
Trpc2 G A 7: 102,090,612 G581D possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubn1 T C 16: 5,070,628 S154P unknown Het
Uchl1 T A 5: 66,676,306 M6K probably damaging Het
Vmn1r193 A T 13: 22,219,819 M1K probably null Het
Wisp1 G A 15: 66,913,051 R191K probably benign Het
Zfp429 T A 13: 67,390,412 K304N probably benign Het
Zfp618 A G 4: 63,118,587 N375D probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp78 A T 7: 6,379,355 D468V probably benign Het
Zfp809 A C 9: 22,239,098 Y297S probably damaging Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 splice site probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
R7840:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7849:Setbp1 UTSW 18 78856853 missense probably benign 0.00
R8147:Setbp1 UTSW 18 78856800 missense probably damaging 1.00
R8354:Setbp1 UTSW 18 78857383 missense probably damaging 1.00
R8446:Setbp1 UTSW 18 78857756 missense probably damaging 1.00
R8524:Setbp1 UTSW 18 78858754 missense probably damaging 1.00
R8534:Setbp1 UTSW 18 78783327 missense possibly damaging 0.86
R8694:Setbp1 UTSW 18 78858301 missense probably damaging 1.00
R8931:Setbp1 UTSW 18 78856508 missense probably benign 0.00
R8983:Setbp1 UTSW 18 78859244 missense probably benign 0.37
R9062:Setbp1 UTSW 18 78857051 missense probably benign 0.01
R9113:Setbp1 UTSW 18 78857733 missense probably damaging 0.99
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGACAGTTCCACAGACACCTAC -3'
(R):5'- CAACTTGCTGCACTGGAAGG -3'

Sequencing Primer
(F):5'- CCCCATGATGAGAGGACTTCTTAAG -3'
(R):5'- GAGGACAAACAGTTGGACTATTTAC -3'
Posted On 2022-04-18