Incidental Mutation 'R9364:Cyp17a1'
ID 708875
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms p450c17, Cyp17, steroid 17-alpha hydroxylase
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R9364 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46655604-46661439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46657165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 361 (R361H)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably damaging
Transcript: ENSMUST00000026012
AA Change: R361H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: R361H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Ankrd17 C T 5: 90,416,508 (GRCm39) R1108Q probably damaging Het
Ccdc136 C T 6: 29,405,960 (GRCm39) A102V probably damaging Het
Ccn4 G A 15: 66,784,900 (GRCm39) R191K probably benign Het
Ccnyl1 A G 1: 64,753,750 (GRCm39) Y187C probably damaging Het
Copa G A 1: 171,944,831 (GRCm39) V882I probably benign Het
Ddx49 T C 8: 70,746,226 (GRCm39) T459A probably benign Het
Depdc5 A G 5: 33,122,076 (GRCm39) N1133S probably benign Het
Dnajc18 T C 18: 35,808,260 (GRCm39) D329G probably damaging Het
Dusp16 G A 6: 134,695,982 (GRCm39) P283L probably damaging Het
Efcab12 A G 6: 115,814,975 (GRCm39) V40A probably benign Het
Emb G T 13: 117,357,096 (GRCm39) probably benign Het
Fam120b G A 17: 15,626,020 (GRCm39) A458T possibly damaging Het
Fgd4 G A 16: 16,308,353 (GRCm39) T9I probably benign Het
Hivep1 G A 13: 42,308,251 (GRCm39) D164N possibly damaging Het
Klf13 T A 7: 63,574,609 (GRCm39) probably benign Het
Lrrc47 T C 4: 154,100,398 (GRCm39) S325P possibly damaging Het
Mast3 C T 8: 71,238,826 (GRCm39) V493M probably damaging Het
Med22 T C 2: 26,795,821 (GRCm39) T200A probably benign Het
Mettl15 T A 2: 108,961,960 (GRCm39) Q216H probably benign Het
Mmel1 A G 4: 154,976,967 (GRCm39) D561G probably null Het
Ms4a4a G A 19: 11,367,708 (GRCm39) M191I probably benign Het
Mtcl3 G A 10: 29,072,775 (GRCm39) R689Q probably damaging Het
Myh11 T A 16: 14,018,580 (GRCm39) N1922I Het
Myo7b T C 18: 32,133,413 (GRCm39) I371V probably benign Het
Myo9b T C 8: 71,808,483 (GRCm39) S1697P probably damaging Het
Neurod4 T C 10: 130,106,840 (GRCm39) T145A probably benign Het
Nfx1 T C 4: 41,023,756 (GRCm39) V1055A probably benign Het
Ntng1 C T 3: 110,042,680 (GRCm39) A49T probably damaging Het
Oc90 G A 15: 65,761,437 (GRCm39) P194S probably benign Het
Opcml A C 9: 28,814,624 (GRCm39) N292T probably damaging Het
Oplah A G 15: 76,193,787 (GRCm39) S57P probably benign Het
Or1x6 T A 11: 50,939,223 (GRCm39) Y96* probably null Het
Or2a12 T A 6: 42,904,534 (GRCm39) I123N probably damaging Het
Or2aj4 T A 16: 19,384,722 (GRCm39) I304F possibly damaging Het
Or8k3b A T 2: 86,520,575 (GRCm39) V248D possibly damaging Het
Pdzd8 A T 19: 59,333,574 (GRCm39) L149Q probably damaging Het
Pid1 A G 1: 84,137,032 (GRCm39) V33A probably benign Het
Prpsap1 A G 11: 116,385,015 (GRCm39) probably benign Het
R3hdml T C 2: 163,334,535 (GRCm39) W42R probably benign Het
Rnase6 A T 14: 51,367,862 (GRCm39) N85Y possibly damaging Het
Scn3a T A 2: 65,291,596 (GRCm39) M1717L possibly damaging Het
Setbp1 C T 18: 78,826,599 (GRCm39) S1338N probably benign Het
Sh2b2 T C 5: 136,253,006 (GRCm39) T389A probably benign Het
Sh2d4a G A 8: 68,747,018 (GRCm39) G82D probably damaging Het
Skint9 A T 4: 112,248,915 (GRCm39) M171K probably benign Het
Slc5a11 C T 7: 122,868,324 (GRCm39) R505W probably damaging Het
Slx4 C A 16: 3,805,820 (GRCm39) M577I probably benign Het
Tarbp1 C T 8: 127,177,462 (GRCm39) V737I probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem100 A T 11: 89,926,533 (GRCm39) E120V probably damaging Het
Trim72 C T 7: 127,609,173 (GRCm39) T325M possibly damaging Het
Trpc2 G A 7: 101,739,819 (GRCm39) G581D possibly damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Ubn1 T C 16: 4,888,492 (GRCm39) S154P unknown Het
Uchl1 T A 5: 66,833,649 (GRCm39) M6K probably damaging Het
Vmn1r193 A T 13: 22,403,989 (GRCm39) M1K probably null Het
Zfp429 T A 13: 67,538,531 (GRCm39) K304N probably benign Het
Zfp618 A G 4: 63,036,824 (GRCm39) N375D probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp78 A T 7: 6,382,354 (GRCm39) D468V probably benign Het
Zfp809 A C 9: 22,150,394 (GRCm39) Y297S probably damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46,659,495 (GRCm39) missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46,659,110 (GRCm39) missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46,659,531 (GRCm39) missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46,661,046 (GRCm39) nonsense probably null
IGL02349:Cyp17a1 APN 19 46,655,936 (GRCm39) missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46,661,005 (GRCm39) missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46,657,790 (GRCm39) missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46,661,050 (GRCm39) missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46,655,796 (GRCm39) missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46,659,474 (GRCm39) missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46,658,162 (GRCm39) missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46,658,990 (GRCm39) missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46,661,093 (GRCm39) missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46,661,095 (GRCm39) missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46,657,761 (GRCm39) missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46,661,159 (GRCm39) missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46,657,673 (GRCm39) missense probably benign
R6729:Cyp17a1 UTSW 19 46,659,020 (GRCm39) missense probably benign
R7025:Cyp17a1 UTSW 19 46,659,419 (GRCm39) missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46,659,134 (GRCm39) missense probably benign
R8056:Cyp17a1 UTSW 19 46,659,030 (GRCm39) missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46,656,516 (GRCm39) missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46,659,533 (GRCm39) critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46,658,166 (GRCm39) missense probably benign 0.09
R9091:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9270:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9554:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46,659,459 (GRCm39) missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46,661,098 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATTGGCAGCAGGAGTCTCTG -3'
(R):5'- GAATCATTCAGGCTGTTCTGGG -3'

Sequencing Primer
(F):5'- CAGCAGGAGTCTCTGTTTGAC -3'
(R):5'- AGGCTGTTCTGGGTATGACCAC -3'
Posted On 2022-04-18