Incidental Mutation 'R9365:Ism1'
ID 708883
Institutional Source Beutler Lab
Gene Symbol Ism1
Ensembl Gene ENSMUSG00000074766
Gene Name isthmin 1, angiogenesis inhibitor
Synonyms 5430433G21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock # R9365 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 139678178-139758581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139740401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 211 (Y211C)
Ref Sequence ENSEMBL: ENSMUSP00000139280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099307] [ENSMUST00000184404]
AlphaFold A2ATD1
Predicted Effect probably damaging
Transcript: ENSMUST00000099307
AA Change: Y204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096910
Gene: ENSMUSG00000074766
AA Change: Y204C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
TSP1 210 252 3.69e-8 SMART
AMOP 279 442 5.38e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184404
AA Change: Y211C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139280
Gene: ENSMUSG00000074766
AA Change: Y211C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 172 184 N/A INTRINSIC
TSP1 217 259 3.69e-8 SMART
AMOP 286 449 5.38e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Ahi1 G A 10: 20,972,136 R481Q probably damaging Het
Arhgef3 T C 14: 27,379,598 I77T probably damaging Het
Ash1l T A 3: 88,981,900 V362E possibly damaging Het
Bcat2 T A 7: 45,575,870 F57L probably damaging Het
Ccdc73 C T 2: 104,907,666 L36F probably damaging Het
Ccl19 C T 4: 42,756,288 V15I probably benign Het
Cenpe T A 3: 135,248,446 V1688E possibly damaging Het
Ces1a A T 8: 93,048,099 F4I probably benign Het
Chchd6 G A 6: 89,574,431 P83S probably benign Het
Cnr1 T C 4: 33,943,798 M62T probably benign Het
Colec12 T C 18: 9,848,146 L108P probably damaging Het
Dhrs4 C T 14: 55,487,319 T181I probably benign Het
Disc1 T C 8: 125,124,546 S392P probably benign Het
Dnah3 A G 7: 119,967,636 F69L Het
Ehmt1 T C 2: 24,838,710 D726G probably damaging Het
Epg5 T A 18: 77,954,742 L462I probably damaging Het
Exoc2 A T 13: 30,856,714 S774T probably benign Het
Fam135b A G 15: 71,462,964 S794P probably benign Het
Frmd4a T C 2: 4,602,162 V646A probably benign Het
Gm3543 G T 14: 41,982,136 D57E possibly damaging Het
Golgb1 T A 16: 36,915,762 D1831E probably damaging Het
Hace1 T G 10: 45,709,996 probably null Het
Irgc1 T C 7: 24,432,447 E315G possibly damaging Het
Kpna1 T G 16: 36,012,917 V121G probably damaging Het
Lifr T A 15: 7,169,040 F250L probably damaging Het
Llgl2 A G 11: 115,849,581 T368A probably benign Het
Lmln T A 16: 33,104,799 C467* probably null Het
Lrrtm3 T C 10: 64,088,164 E408G probably benign Het
Melk C T 4: 44,340,693 A330V probably null Het
Mmp13 T G 9: 7,277,921 D271E probably benign Het
Myh11 T C 16: 14,234,433 T390A Het
Myh8 A G 11: 67,283,806 K249R probably benign Het
Nr1h4 T A 10: 89,483,453 M184L probably damaging Het
Obscn T A 11: 58,994,511 probably null Het
Otog T G 7: 46,271,264 C964G probably damaging Het
Oxct2b T C 4: 123,116,796 S170P probably benign Het
Pcdha4 T C 18: 36,954,059 S432P possibly damaging Het
Prb1 T A 6: 132,207,238 R477S unknown Het
Prh1 G A 6: 132,572,145 G205D unknown Het
Psg23 C T 7: 18,610,468 G354D probably damaging Het
Pura T G 18: 36,287,860 D233E possibly damaging Het
Rb1cc1 G T 1: 6,244,893 L423F probably damaging Het
Rimbp3 T C 16: 17,208,756 S15P possibly damaging Het
Scn1a A G 2: 66,318,121 F7L probably benign Het
Sftpb A T 6: 72,307,205 R203* probably null Het
Slc30a9 A G 5: 67,349,799 K478R probably damaging Het
Slc35f5 T A 1: 125,568,596 M156K probably benign Het
Slc41a3 A G 6: 90,635,345 I232V probably benign Het
Slit2 A G 5: 48,304,192 D1527G probably benign Het
Srfbp1 T G 18: 52,490,468 V389G possibly damaging Het
Sun2 C T 15: 79,738,519 probably null Het
Tep1 G T 14: 50,827,140 A2386D probably damaging Het
Tex15 T A 8: 33,574,536 S1331R possibly damaging Het
Tgm1 A T 14: 55,704,892 N667K probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tsen54 T C 11: 115,822,584 F438L probably damaging Het
Ube4a T C 9: 44,950,893 H150R probably benign Het
Uty T C Y: 1,099,712 N1161S possibly damaging Het
Vmn2r16 T A 5: 109,340,198 D312E probably damaging Het
Wdr55 T G 18: 36,760,301 C5W probably damaging Het
Zbtb24 C A 10: 41,456,544 P405Q probably damaging Het
Zkscan2 T A 7: 123,480,368 I789F probably damaging Het
Other mutations in Ism1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Ism1 APN 2 139757303 missense probably damaging 1.00
IGL02496:Ism1 APN 2 139757201 missense probably damaging 1.00
IGL03349:Ism1 APN 2 139731975 nonsense probably null
R0212:Ism1 UTSW 2 139740257 missense probably benign 0.00
R0312:Ism1 UTSW 2 139678672 start codon destroyed probably null 0.88
R1355:Ism1 UTSW 2 139732074 missense possibly damaging 0.93
R1370:Ism1 UTSW 2 139732074 missense possibly damaging 0.93
R1775:Ism1 UTSW 2 139746043 missense probably damaging 1.00
R1992:Ism1 UTSW 2 139746017 missense probably benign 0.01
R2021:Ism1 UTSW 2 139740127 splice site probably null
R2035:Ism1 UTSW 2 139757155 missense probably damaging 1.00
R2270:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R2271:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R3722:Ism1 UTSW 2 139732011 nonsense probably null
R3792:Ism1 UTSW 2 139740253 missense probably damaging 0.99
R4907:Ism1 UTSW 2 139678752 missense probably benign 0.27
R5621:Ism1 UTSW 2 139678721 missense probably damaging 0.99
R5964:Ism1 UTSW 2 139678757 missense probably benign
R6255:Ism1 UTSW 2 139746042 small deletion probably benign
R7009:Ism1 UTSW 2 139757279 missense probably damaging 1.00
R7325:Ism1 UTSW 2 139757043 missense probably damaging 1.00
R7851:Ism1 UTSW 2 139757265 missense probably damaging 1.00
R8851:Ism1 UTSW 2 139749545 missense probably damaging 1.00
R8958:Ism1 UTSW 2 139732075 missense possibly damaging 0.93
Z1176:Ism1 UTSW 2 139731874 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATAGAGGTGGTTGATGGCC -3'
(R):5'- AGCTTCATGGGACTTCTGTG -3'

Sequencing Primer
(F):5'- TTGATGGCCCTGACTCCGAAG -3'
(R):5'- AGCTTCATGGGACTTCTGTGAAGAC -3'
Posted On 2022-04-18