Incidental Mutation 'R9365:Cenpe'
ID 708885
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, CENP-E, Kif10, N-7 kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9365 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 135212537-135273611 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 135248446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1688 (V1688E)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000062893
AA Change: V1688E

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: V1688E

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Ahi1 G A 10: 20,972,136 R481Q probably damaging Het
Arhgef3 T C 14: 27,379,598 I77T probably damaging Het
Ash1l T A 3: 88,981,900 V362E possibly damaging Het
Bcat2 T A 7: 45,575,870 F57L probably damaging Het
Ccdc73 C T 2: 104,907,666 L36F probably damaging Het
Ccl19 C T 4: 42,756,288 V15I probably benign Het
Ces1a A T 8: 93,048,099 F4I probably benign Het
Chchd6 G A 6: 89,574,431 P83S probably benign Het
Cnr1 T C 4: 33,943,798 M62T probably benign Het
Colec12 T C 18: 9,848,146 L108P probably damaging Het
Dhrs4 C T 14: 55,487,319 T181I probably benign Het
Disc1 T C 8: 125,124,546 S392P probably benign Het
Dnah3 A G 7: 119,967,636 F69L Het
Ehmt1 T C 2: 24,838,710 D726G probably damaging Het
Epg5 T A 18: 77,954,742 L462I probably damaging Het
Exoc2 A T 13: 30,856,714 S774T probably benign Het
Fam135b A G 15: 71,462,964 S794P probably benign Het
Frmd4a T C 2: 4,602,162 V646A probably benign Het
Gm3543 G T 14: 41,982,136 D57E possibly damaging Het
Golgb1 T A 16: 36,915,762 D1831E probably damaging Het
Hace1 T G 10: 45,709,996 probably null Het
Irgc1 T C 7: 24,432,447 E315G possibly damaging Het
Ism1 A G 2: 139,740,401 Y211C probably damaging Het
Kpna1 T G 16: 36,012,917 V121G probably damaging Het
Lifr T A 15: 7,169,040 F250L probably damaging Het
Llgl2 A G 11: 115,849,581 T368A probably benign Het
Lmln T A 16: 33,104,799 C467* probably null Het
Lrrtm3 T C 10: 64,088,164 E408G probably benign Het
Melk C T 4: 44,340,693 A330V probably null Het
Mmp13 T G 9: 7,277,921 D271E probably benign Het
Myh11 T C 16: 14,234,433 T390A Het
Myh8 A G 11: 67,283,806 K249R probably benign Het
Nr1h4 T A 10: 89,483,453 M184L probably damaging Het
Obscn T A 11: 58,994,511 probably null Het
Otog T G 7: 46,271,264 C964G probably damaging Het
Oxct2b T C 4: 123,116,796 S170P probably benign Het
Pcdha4 T C 18: 36,954,059 S432P possibly damaging Het
Prb1 T A 6: 132,207,238 R477S unknown Het
Prh1 G A 6: 132,572,145 G205D unknown Het
Psg23 C T 7: 18,610,468 G354D probably damaging Het
Pura T G 18: 36,287,860 D233E possibly damaging Het
Rb1cc1 G T 1: 6,244,893 L423F probably damaging Het
Rimbp3 T C 16: 17,208,756 S15P possibly damaging Het
Scn1a A G 2: 66,318,121 F7L probably benign Het
Sftpb A T 6: 72,307,205 R203* probably null Het
Slc30a9 A G 5: 67,349,799 K478R probably damaging Het
Slc35f5 T A 1: 125,568,596 M156K probably benign Het
Slc41a3 A G 6: 90,635,345 I232V probably benign Het
Slit2 A G 5: 48,304,192 D1527G probably benign Het
Srfbp1 T G 18: 52,490,468 V389G possibly damaging Het
Sun2 C T 15: 79,738,519 probably null Het
Tep1 G T 14: 50,827,140 A2386D probably damaging Het
Tex15 T A 8: 33,574,536 S1331R possibly damaging Het
Tgm1 A T 14: 55,704,892 N667K probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tsen54 T C 11: 115,822,584 F438L probably damaging Het
Ube4a T C 9: 44,950,893 H150R probably benign Het
Uty T C Y: 1,099,712 N1161S possibly damaging Het
Vmn2r16 T A 5: 109,340,198 D312E probably damaging Het
Wdr55 T G 18: 36,760,301 C5W probably damaging Het
Zbtb24 C A 10: 41,456,544 P405Q probably damaging Het
Zkscan2 T A 7: 123,480,368 I789F probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7973:Cenpe UTSW 3 135223250 missense probably damaging 1.00
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8191:Cenpe UTSW 3 135251614 missense probably benign
R8251:Cenpe UTSW 3 135251684 critical splice donor site probably null
R8425:Cenpe UTSW 3 135242627 nonsense probably null
R8488:Cenpe UTSW 3 135259241 missense probably damaging 1.00
R8811:Cenpe UTSW 3 135223240 missense probably damaging 1.00
R8850:Cenpe UTSW 3 135225016 missense probably damaging 1.00
R8879:Cenpe UTSW 3 135260101 missense probably damaging 0.99
R8899:Cenpe UTSW 3 135239883 missense probably benign 0.18
R9035:Cenpe UTSW 3 135270811 missense probably benign 0.01
R9038:Cenpe UTSW 3 135218036 missense probably benign 0.00
R9093:Cenpe UTSW 3 135239880 nonsense probably null
R9221:Cenpe UTSW 3 135230078 missense possibly damaging 0.90
R9443:Cenpe UTSW 3 135270848 missense probably damaging 0.99
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCCATGATGAAACAGGATGTGATC -3'
(R):5'- TGCTGAAGACTTTTCCGTAGC -3'

Sequencing Primer
(F):5'- CATGTCTAAATCTGAAGGCTCACGTG -3'
(R):5'- AAGACTTTTCCGTAGCTGGTC -3'
Posted On 2022-04-18