Incidental Mutation 'R9365:Melk'
ID 708888
Institutional Source Beutler Lab
Gene Symbol Melk
Ensembl Gene ENSMUSG00000035683
Gene Name maternal embryonic leucine zipper kinase
Synonyms MPK38
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9365 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 44300876-44364301 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44340693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 330 (A330V)
Ref Sequence ENSEMBL: ENSMUSP00000043806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045607]
AlphaFold Q61846
PDB Structure The crystal structure of mouse PK38 [X-RAY DIFFRACTION]
The crystal structure of MPK38 in complex with OTSSP167, an orally- administrative MELK selective inhibitor [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000045607
AA Change: A330V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043806
Gene: ENSMUSG00000035683
AA Change: A330V

DomainStartEndE-ValueType
S_TKc 11 263 2.64e-105 SMART
low complexity region 313 325 N/A INTRINSIC
Pfam:KA1 599 643 2.2e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for an allele that produces a kinase-dead protein exhibit altered pancreatic regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Ahi1 G A 10: 20,848,035 (GRCm39) R481Q probably damaging Het
Arhgef3 T C 14: 27,101,555 (GRCm39) I77T probably damaging Het
Ash1l T A 3: 88,889,207 (GRCm39) V362E possibly damaging Het
Bcat2 T A 7: 45,225,294 (GRCm39) F57L probably damaging Het
Ccdc73 C T 2: 104,738,011 (GRCm39) L36F probably damaging Het
Ccl19 C T 4: 42,756,288 (GRCm39) V15I probably benign Het
Cenpe T A 3: 134,954,207 (GRCm39) V1688E possibly damaging Het
Ces1a A T 8: 93,774,727 (GRCm39) F4I probably benign Het
Chchd6 G A 6: 89,551,413 (GRCm39) P83S probably benign Het
Cnr1 T C 4: 33,943,798 (GRCm39) M62T probably benign Het
Colec12 T C 18: 9,848,146 (GRCm39) L108P probably damaging Het
Cyb5a T C 18: 84,894,979 (GRCm39) probably benign Het
Dhrs4 C T 14: 55,724,776 (GRCm39) T181I probably benign Het
Disc1 T C 8: 125,851,285 (GRCm39) S392P probably benign Het
Dnah3 A G 7: 119,566,859 (GRCm39) F69L Het
Ehmt1 T C 2: 24,728,722 (GRCm39) D726G probably damaging Het
Epg5 T A 18: 77,997,957 (GRCm39) L462I probably damaging Het
Exoc2 A T 13: 31,040,697 (GRCm39) S774T probably benign Het
Fam135b A G 15: 71,334,813 (GRCm39) S794P probably benign Het
Frmd4a T C 2: 4,606,973 (GRCm39) V646A probably benign Het
Gm3543 G T 14: 41,804,093 (GRCm39) D57E possibly damaging Het
Golgb1 T A 16: 36,736,124 (GRCm39) D1831E probably damaging Het
Hace1 T G 10: 45,586,092 (GRCm39) probably null Het
Irgc T C 7: 24,131,872 (GRCm39) E315G possibly damaging Het
Ism1 A G 2: 139,582,321 (GRCm39) Y211C probably damaging Het
Kpna1 T G 16: 35,833,287 (GRCm39) V121G probably damaging Het
Lifr T A 15: 7,198,521 (GRCm39) F250L probably damaging Het
Llgl2 A G 11: 115,740,407 (GRCm39) T368A probably benign Het
Lmln T A 16: 32,925,169 (GRCm39) C467* probably null Het
Lrrtm3 T C 10: 63,923,943 (GRCm39) E408G probably benign Het
Mmp13 T G 9: 7,277,921 (GRCm39) D271E probably benign Het
Myh11 T C 16: 14,052,297 (GRCm39) T390A Het
Myh8 A G 11: 67,174,632 (GRCm39) K249R probably benign Het
Nr1h4 T A 10: 89,319,315 (GRCm39) M184L probably damaging Het
Obscn T A 11: 58,885,337 (GRCm39) probably null Het
Otog T G 7: 45,920,688 (GRCm39) C964G probably damaging Het
Oxct2b T C 4: 123,010,589 (GRCm39) S170P probably benign Het
Pcdha4 T C 18: 37,087,112 (GRCm39) S432P possibly damaging Het
Prb1a T A 6: 132,184,201 (GRCm39) R477S unknown Het
Prh1 G A 6: 132,549,108 (GRCm39) G205D unknown Het
Psg23 C T 7: 18,344,393 (GRCm39) G354D probably damaging Het
Pura T G 18: 36,420,913 (GRCm39) D233E possibly damaging Het
Rb1cc1 G T 1: 6,315,117 (GRCm39) L423F probably damaging Het
Rimbp3 T C 16: 17,026,620 (GRCm39) S15P possibly damaging Het
Scn1a A G 2: 66,148,465 (GRCm39) F7L probably benign Het
Sftpb A T 6: 72,284,189 (GRCm39) R203* probably null Het
Slc30a9 A G 5: 67,507,142 (GRCm39) K478R probably damaging Het
Slc35f5 T A 1: 125,496,333 (GRCm39) M156K probably benign Het
Slc41a3 A G 6: 90,612,327 (GRCm39) I232V probably benign Het
Slit2 A G 5: 48,461,534 (GRCm39) D1527G probably benign Het
Srfbp1 T G 18: 52,623,540 (GRCm39) V389G possibly damaging Het
Sun2 C T 15: 79,622,720 (GRCm39) probably null Het
Tep1 G T 14: 51,064,597 (GRCm39) A2386D probably damaging Het
Tex15 T A 8: 34,064,564 (GRCm39) S1331R possibly damaging Het
Tgm1 A T 14: 55,942,349 (GRCm39) N667K probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tsen54 T C 11: 115,713,410 (GRCm39) F438L probably damaging Het
Ube4a T C 9: 44,862,191 (GRCm39) H150R probably benign Het
Uty T C Y: 1,099,712 (GRCm39) N1161S possibly damaging Het
Vmn2r16 T A 5: 109,488,064 (GRCm39) D312E probably damaging Het
Wdr55 T G 18: 36,893,354 (GRCm39) C5W probably damaging Het
Zbtb24 C A 10: 41,332,540 (GRCm39) P405Q probably damaging Het
Zkscan2 T A 7: 123,079,591 (GRCm39) I789F probably damaging Het
Other mutations in Melk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Melk APN 4 44,347,262 (GRCm39) missense probably benign 0.05
IGL01367:Melk APN 4 44,332,907 (GRCm39) missense possibly damaging 0.62
IGL01865:Melk APN 4 44,344,988 (GRCm39) missense probably benign 0.00
IGL02801:Melk APN 4 44,360,930 (GRCm39) missense probably damaging 0.99
R0037:Melk UTSW 4 44,360,864 (GRCm39) splice site probably benign
R0433:Melk UTSW 4 44,340,614 (GRCm39) splice site probably benign
R0570:Melk UTSW 4 44,308,906 (GRCm39) missense probably damaging 1.00
R0786:Melk UTSW 4 44,303,649 (GRCm39) missense unknown
R1483:Melk UTSW 4 44,308,937 (GRCm39) missense probably damaging 1.00
R2042:Melk UTSW 4 44,309,051 (GRCm39) critical splice donor site probably null
R3831:Melk UTSW 4 44,345,021 (GRCm39) missense probably benign 0.05
R5060:Melk UTSW 4 44,350,959 (GRCm39) missense probably benign 0.15
R5236:Melk UTSW 4 44,344,959 (GRCm39) missense probably benign
R5269:Melk UTSW 4 44,363,730 (GRCm39) missense probably damaging 1.00
R5357:Melk UTSW 4 44,363,730 (GRCm39) missense probably damaging 1.00
R5358:Melk UTSW 4 44,363,730 (GRCm39) missense probably damaging 1.00
R5360:Melk UTSW 4 44,363,730 (GRCm39) missense probably damaging 1.00
R5430:Melk UTSW 4 44,309,033 (GRCm39) missense probably damaging 1.00
R5576:Melk UTSW 4 44,312,255 (GRCm39) missense probably null 1.00
R5656:Melk UTSW 4 44,312,237 (GRCm39) missense possibly damaging 0.95
R5738:Melk UTSW 4 44,310,333 (GRCm39) missense probably damaging 1.00
R5972:Melk UTSW 4 44,351,007 (GRCm39) missense probably benign 0.01
R6265:Melk UTSW 4 44,318,109 (GRCm39) missense probably damaging 1.00
R6340:Melk UTSW 4 44,340,633 (GRCm39) missense probably damaging 1.00
R7202:Melk UTSW 4 44,351,106 (GRCm39) missense probably benign
R7242:Melk UTSW 4 44,360,885 (GRCm39) missense probably damaging 1.00
R7328:Melk UTSW 4 44,332,931 (GRCm39) missense probably benign
R7608:Melk UTSW 4 44,325,571 (GRCm39) splice site probably null
R8053:Melk UTSW 4 44,318,109 (GRCm39) missense probably damaging 1.00
R8185:Melk UTSW 4 44,360,965 (GRCm39) missense probably benign 0.14
R8356:Melk UTSW 4 44,312,191 (GRCm39) missense possibly damaging 0.75
R8456:Melk UTSW 4 44,312,191 (GRCm39) missense possibly damaging 0.75
R9749:Melk UTSW 4 44,307,067 (GRCm39) missense possibly damaging 0.63
X0020:Melk UTSW 4 44,349,876 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACGTCTGAAGCTGTTGACTG -3'
(R):5'- TCTCACCACGATGTTTAAACCC -3'

Sequencing Primer
(F):5'- ACGTCTGAAGCTGTTGACTGAATTC -3'
(R):5'- CACAGTGGTCAAGTACTTGGC -3'
Posted On 2022-04-18