Incidental Mutation 'R9365:Otog'
ID 708903
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Name otogelin
Synonyms Otgn
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock # R9365 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 46240987-46311434 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 46271264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 964 (C964G)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000164538
AA Change: C964G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: C964G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Ahi1 G A 10: 20,972,136 R481Q probably damaging Het
Arhgef3 T C 14: 27,379,598 I77T probably damaging Het
Ash1l T A 3: 88,981,900 V362E possibly damaging Het
Bcat2 T A 7: 45,575,870 F57L probably damaging Het
Ccdc73 C T 2: 104,907,666 L36F probably damaging Het
Ccl19 C T 4: 42,756,288 V15I probably benign Het
Cenpe T A 3: 135,248,446 V1688E possibly damaging Het
Ces1a A T 8: 93,048,099 F4I probably benign Het
Chchd6 G A 6: 89,574,431 P83S probably benign Het
Cnr1 T C 4: 33,943,798 M62T probably benign Het
Colec12 T C 18: 9,848,146 L108P probably damaging Het
Dhrs4 C T 14: 55,487,319 T181I probably benign Het
Disc1 T C 8: 125,124,546 S392P probably benign Het
Dnah3 A G 7: 119,967,636 F69L Het
Ehmt1 T C 2: 24,838,710 D726G probably damaging Het
Epg5 T A 18: 77,954,742 L462I probably damaging Het
Exoc2 A T 13: 30,856,714 S774T probably benign Het
Fam135b A G 15: 71,462,964 S794P probably benign Het
Frmd4a T C 2: 4,602,162 V646A probably benign Het
Gm3543 G T 14: 41,982,136 D57E possibly damaging Het
Golgb1 T A 16: 36,915,762 D1831E probably damaging Het
Hace1 T G 10: 45,709,996 probably null Het
Irgc1 T C 7: 24,432,447 E315G possibly damaging Het
Ism1 A G 2: 139,740,401 Y211C probably damaging Het
Kpna1 T G 16: 36,012,917 V121G probably damaging Het
Lifr T A 15: 7,169,040 F250L probably damaging Het
Llgl2 A G 11: 115,849,581 T368A probably benign Het
Lmln T A 16: 33,104,799 C467* probably null Het
Lrrtm3 T C 10: 64,088,164 E408G probably benign Het
Melk C T 4: 44,340,693 A330V probably null Het
Mmp13 T G 9: 7,277,921 D271E probably benign Het
Myh11 T C 16: 14,234,433 T390A Het
Myh8 A G 11: 67,283,806 K249R probably benign Het
Nr1h4 T A 10: 89,483,453 M184L probably damaging Het
Obscn T A 11: 58,994,511 probably null Het
Oxct2b T C 4: 123,116,796 S170P probably benign Het
Pcdha4 T C 18: 36,954,059 S432P possibly damaging Het
Prb1 T A 6: 132,207,238 R477S unknown Het
Prh1 G A 6: 132,572,145 G205D unknown Het
Psg23 C T 7: 18,610,468 G354D probably damaging Het
Pura T G 18: 36,287,860 D233E possibly damaging Het
Rb1cc1 G T 1: 6,244,893 L423F probably damaging Het
Rimbp3 T C 16: 17,208,756 S15P possibly damaging Het
Scn1a A G 2: 66,318,121 F7L probably benign Het
Sftpb A T 6: 72,307,205 R203* probably null Het
Slc30a9 A G 5: 67,349,799 K478R probably damaging Het
Slc35f5 T A 1: 125,568,596 M156K probably benign Het
Slc41a3 A G 6: 90,635,345 I232V probably benign Het
Slit2 A G 5: 48,304,192 D1527G probably benign Het
Srfbp1 T G 18: 52,490,468 V389G possibly damaging Het
Sun2 C T 15: 79,738,519 probably null Het
Tep1 G T 14: 50,827,140 A2386D probably damaging Het
Tex15 T A 8: 33,574,536 S1331R possibly damaging Het
Tgm1 A T 14: 55,704,892 N667K probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tsen54 T C 11: 115,822,584 F438L probably damaging Het
Ube4a T C 9: 44,950,893 H150R probably benign Het
Uty T C Y: 1,099,712 N1161S possibly damaging Het
Vmn2r16 T A 5: 109,340,198 D312E probably damaging Het
Wdr55 T G 18: 36,760,301 C5W probably damaging Het
Zbtb24 C A 10: 41,456,544 P405Q probably damaging Het
Zkscan2 T A 7: 123,480,368 I789F probably damaging Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
R0282_Otog_616 UTSW 7 46277493 missense possibly damaging 0.93
R0636_otog_678 UTSW 7 46264228 critical splice donor site probably null
R1029_otog_141 UTSW 7 46274595 missense probably damaging 1.00
BB010:Otog UTSW 7 46310147 missense probably damaging 1.00
BB020:Otog UTSW 7 46310147 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7468:Otog UTSW 7 46264119 missense probably benign
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
R7502:Otog UTSW 7 46298615 missense probably damaging 1.00
R7558:Otog UTSW 7 46303160 missense probably damaging 0.99
R7577:Otog UTSW 7 46287855 missense possibly damaging 0.62
R7651:Otog UTSW 7 46241761 missense probably benign 0.00
R7689:Otog UTSW 7 46252056 missense probably damaging 1.00
R7806:Otog UTSW 7 46285776 missense probably benign
R7933:Otog UTSW 7 46310147 missense probably damaging 1.00
R8021:Otog UTSW 7 46267342 missense probably damaging 0.98
R8082:Otog UTSW 7 46289719 missense probably damaging 1.00
R8531:Otog UTSW 7 46252049 missense probably damaging 0.99
R8772:Otog UTSW 7 46284928 missense probably damaging 1.00
R8816:Otog UTSW 7 46301481 missense possibly damaging 0.92
R8842:Otog UTSW 7 46246524 missense probably damaging 1.00
R8987:Otog UTSW 7 46287454 missense probably benign 0.43
R8988:Otog UTSW 7 46310147 missense probably damaging 1.00
R9010:Otog UTSW 7 46300470 missense probably benign 0.00
R9025:Otog UTSW 7 46288096 missense probably benign 0.13
R9131:Otog UTSW 7 46303173 nonsense probably null
R9179:Otog UTSW 7 46288461 missense possibly damaging 0.65
R9334:Otog UTSW 7 46259929 missense possibly damaging 0.95
R9408:Otog UTSW 7 46267297 missense possibly damaging 0.79
R9418:Otog UTSW 7 46288600 missense probably benign 0.41
R9465:Otog UTSW 7 46305875 missense possibly damaging 0.80
R9496:Otog UTSW 7 46241081 missense unknown
RF024:Otog UTSW 7 46287669 missense probably damaging 1.00
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Z1177:Otog UTSW 7 46262852 missense possibly damaging 0.80
Z1177:Otog UTSW 7 46274538 missense probably damaging 1.00
Z1177:Otog UTSW 7 46289740 missense probably damaging 1.00
Z1177:Otog UTSW 7 46309985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGTGCAAACATTCTGCCTC -3'
(R):5'- GGTCCAGATCACCACACATCTG -3'

Sequencing Primer
(F):5'- GCAAACATTCTGCCTCCCTGG -3'
(R):5'- ACACATCTGACAGGTCCTGGTC -3'
Posted On 2022-04-18