Mutagenetix > Incidental Mutation

Incidental Mutation 'R9365:Tex15'

708906

Institutional Source

Beutler Lab

Gene Symbol

Tex15

Ensembl Gene

ENSMUSG00000009628

Gene Name

testis expressed gene 15

Synonyms

2210014E14Rik

Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R9365 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33516738-33585582 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 33574536 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1331 (S1331R)

Ref Sequence

ENSEMBL: ENSMUSP00000009772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000009772
AA Change: S1331R

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: S1331R

Domain	Start	End	E-Value	Type
low complexity region	262	274	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	524	536	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	713	725	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1497	1508	N/A	INTRINSIC
Pfam:TEX15	1572	1788	1.3e-109	PFAM
Pfam:TEX15	1901	2119	1.1e-16	PFAM
low complexity region	2758	2770	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124496

SMART Domains

Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	89	251	1.6e-58	PFAM
low complexity region	536	548	N/A	INTRINSIC
low complexity region	576	587	N/A	INTRINSIC
low complexity region	798	810	N/A	INTRINSIC
low complexity region	939	948	N/A	INTRINSIC
low complexity region	987	999	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124501

SMART Domains

Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	96	251	2.4e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
Ahi1	G	A	10: 20,972,136	R481Q	probably damaging	Het
Arhgef3	T	C	14: 27,379,598	I77T	probably damaging	Het
Ash1l	T	A	3: 88,981,900	V362E	possibly damaging	Het
Bcat2	T	A	7: 45,575,870	F57L	probably damaging	Het
Ccdc73	C	T	2: 104,907,666	L36F	probably damaging	Het
Ccl19	C	T	4: 42,756,288	V15I	probably benign	Het
Cenpe	T	A	3: 135,248,446	V1688E	possibly damaging	Het
Ces1a	A	T	8: 93,048,099	F4I	probably benign	Het
Chchd6	G	A	6: 89,574,431	P83S	probably benign	Het
Cnr1	T	C	4: 33,943,798	M62T	probably benign	Het
Colec12	T	C	18: 9,848,146	L108P	probably damaging	Het
Dhrs4	C	T	14: 55,487,319	T181I	probably benign	Het
Disc1	T	C	8: 125,124,546	S392P	probably benign	Het
Dnah3	A	G	7: 119,967,636	F69L		Het
Ehmt1	T	C	2: 24,838,710	D726G	probably damaging	Het
Epg5	T	A	18: 77,954,742	L462I	probably damaging	Het
Exoc2	A	T	13: 30,856,714	S774T	probably benign	Het
Fam135b	A	G	15: 71,462,964	S794P	probably benign	Het
Frmd4a	T	C	2: 4,602,162	V646A	probably benign	Het
Gm3543	G	T	14: 41,982,136	D57E	possibly damaging	Het
Golgb1	T	A	16: 36,915,762	D1831E	probably damaging	Het
Hace1	T	G	10: 45,709,996		probably null	Het
Irgc1	T	C	7: 24,432,447	E315G	possibly damaging	Het
Ism1	A	G	2: 139,740,401	Y211C	probably damaging	Het
Kpna1	T	G	16: 36,012,917	V121G	probably damaging	Het
Lifr	T	A	15: 7,169,040	F250L	probably damaging	Het
Llgl2	A	G	11: 115,849,581	T368A	probably benign	Het
Lmln	T	A	16: 33,104,799	C467*	probably null	Het
Lrrtm3	T	C	10: 64,088,164	E408G	probably benign	Het
Melk	C	T	4: 44,340,693	A330V	probably null	Het
Mmp13	T	G	9: 7,277,921	D271E	probably benign	Het
Myh11	T	C	16: 14,234,433	T390A		Het
Myh8	A	G	11: 67,283,806	K249R	probably benign	Het
Nr1h4	T	A	10: 89,483,453	M184L	probably damaging	Het
Obscn	T	A	11: 58,994,511		probably null	Het
Otog	T	G	7: 46,271,264	C964G	probably damaging	Het
Oxct2b	T	C	4: 123,116,796	S170P	probably benign	Het
Pcdha4	T	C	18: 36,954,059	S432P	possibly damaging	Het
Prb1	T	A	6: 132,207,238	R477S	unknown	Het
Prh1	G	A	6: 132,572,145	G205D	unknown	Het
Psg23	C	T	7: 18,610,468	G354D	probably damaging	Het
Pura	T	G	18: 36,287,860	D233E	possibly damaging	Het
Rb1cc1	G	T	1: 6,244,893	L423F	probably damaging	Het
Rimbp3	T	C	16: 17,208,756	S15P	possibly damaging	Het
Scn1a	A	G	2: 66,318,121	F7L	probably benign	Het
Sftpb	A	T	6: 72,307,205	R203*	probably null	Het
Slc30a9	A	G	5: 67,349,799	K478R	probably damaging	Het
Slc35f5	T	A	1: 125,568,596	M156K	probably benign	Het
Slc41a3	A	G	6: 90,635,345	I232V	probably benign	Het
Slit2	A	G	5: 48,304,192	D1527G	probably benign	Het
Srfbp1	T	G	18: 52,490,468	V389G	possibly damaging	Het
Sun2	C	T	15: 79,738,519		probably null	Het
Tep1	G	T	14: 50,827,140	A2386D	probably damaging	Het
Tgm1	A	T	14: 55,704,892	N667K	probably damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tsen54	T	C	11: 115,822,584	F438L	probably damaging	Het
Ube4a	T	C	9: 44,950,893	H150R	probably benign	Het
Uty	T	C	Y: 1,099,712	N1161S	possibly damaging	Het
Vmn2r16	T	A	5: 109,340,198	D312E	probably damaging	Het
Wdr55	T	G	18: 36,760,301	C5W	probably damaging	Het
Zbtb24	C	A	10: 41,456,544	P405Q	probably damaging	Het
Zkscan2	T	A	7: 123,480,368	I789F	probably damaging	Het

Other mutations in Tex15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Tex15	APN	8	33575311	missense	probably benign	0.18
IGL00705:Tex15	APN	8	33581592	missense	probably damaging	1.00
IGL00820:Tex15	APN	8	33579006	splice site	probably benign
IGL01288:Tex15	APN	8	33571384	missense	probably benign	0.02
IGL01328:Tex15	APN	8	33571396	nonsense	probably null
IGL01359:Tex15	APN	8	33581898	missense	probably damaging	0.99
IGL01603:Tex15	APN	8	33573547	missense	possibly damaging	0.93
IGL01861:Tex15	APN	8	33570689	missense	probably damaging	1.00
IGL02052:Tex15	APN	8	33582465	missense	probably benign	0.28
IGL02560:Tex15	APN	8	33581751	missense	probably benign	0.00
IGL02677:Tex15	APN	8	33571080	missense	probably benign	0.03
IGL02739:Tex15	APN	8	33581693	missense	possibly damaging	0.68
Big_gulp	UTSW	8	33581734	missense	probably damaging	1.00
P0005:Tex15	UTSW	8	33570868	missense	probably benign	0.00
P0037:Tex15	UTSW	8	33581580	missense	probably benign	0.00
PIT4377001:Tex15	UTSW	8	33571101	missense	probably damaging	1.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0595:Tex15	UTSW	8	33572617	missense	probably damaging	1.00
R0646:Tex15	UTSW	8	33582326	missense	possibly damaging	0.83
R0688:Tex15	UTSW	8	33573500	missense	probably damaging	1.00
R0842:Tex15	UTSW	8	33571547	missense	possibly damaging	0.95
R0987:Tex15	UTSW	8	33576847	missense	probably damaging	1.00
R1084:Tex15	UTSW	8	33577004	missense	probably benign	0.28
R1183:Tex15	UTSW	8	33574865	missense	probably benign	0.35
R1186:Tex15	UTSW	8	33571633	missense	probably benign	0.19
R1378:Tex15	UTSW	8	33575216	missense	probably damaging	0.99
R1500:Tex15	UTSW	8	33575092	missense	probably damaging	0.96
R1508:Tex15	UTSW	8	33576852	missense	probably damaging	1.00
R1597:Tex15	UTSW	8	33571483	missense	probably damaging	0.96
R1636:Tex15	UTSW	8	33576387	nonsense	probably null
R1639:Tex15	UTSW	8	33570817	missense	possibly damaging	0.94
R1809:Tex15	UTSW	8	33574234	missense	probably benign
R1843:Tex15	UTSW	8	33576654	missense	probably benign	0.27
R2029:Tex15	UTSW	8	33571274	missense	probably damaging	0.99
R2228:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2229:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2245:Tex15	UTSW	8	33571496	missense	possibly damaging	0.77
R2246:Tex15	UTSW	8	33582512	missense	possibly damaging	0.49
R2880:Tex15	UTSW	8	33574907	nonsense	probably null
R2881:Tex15	UTSW	8	33574907	nonsense	probably null
R2882:Tex15	UTSW	8	33574907	nonsense	probably null
R3001:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3002:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3020:Tex15	UTSW	8	33576670	missense	probably damaging	1.00
R3084:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3085:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3701:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3702:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3752:Tex15	UTSW	8	33571415	missense	probably benign
R4162:Tex15	UTSW	8	33581558	missense	probably damaging	1.00
R4231:Tex15	UTSW	8	33572137	missense	probably damaging	0.99
R4589:Tex15	UTSW	8	33557373	missense	probably damaging	1.00
R4707:Tex15	UTSW	8	33582497	missense	probably benign	0.00
R4773:Tex15	UTSW	8	33582732	missense	probably benign	0.42
R4967:Tex15	UTSW	8	33574470	missense	probably benign	0.34
R5063:Tex15	UTSW	8	33582610	missense	possibly damaging	0.59
R5121:Tex15	UTSW	8	33571766	missense	probably damaging	1.00
R5147:Tex15	UTSW	8	33572312	nonsense	probably null
R5166:Tex15	UTSW	8	33576392	missense	probably benign	0.07
R5173:Tex15	UTSW	8	33571740	missense	possibly damaging	0.73
R5439:Tex15	UTSW	8	33574171	missense	possibly damaging	0.93
R5537:Tex15	UTSW	8	33571613	missense	probably damaging	1.00
R5580:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R5588:Tex15	UTSW	8	33577187	missense	probably damaging	1.00
R5696:Tex15	UTSW	8	33573192	missense	probably benign	0.01
R5734:Tex15	UTSW	8	33546336	missense	probably benign	0.01
R5756:Tex15	UTSW	8	33575833	missense	probably benign	0.17
R5823:Tex15	UTSW	8	33570934	missense	possibly damaging	0.67
R6126:Tex15	UTSW	8	33573563	missense	probably benign	0.19
R6129:Tex15	UTSW	8	33574130	missense	possibly damaging	0.90
R6276:Tex15	UTSW	8	33577189	missense	possibly damaging	0.93
R6374:Tex15	UTSW	8	33575912	missense	probably damaging	1.00
R6430:Tex15	UTSW	8	33571301	missense	probably benign	0.01
R6452:Tex15	UTSW	8	33572816	missense	probably damaging	1.00
R6471:Tex15	UTSW	8	33581734	missense	probably damaging	1.00
R6700:Tex15	UTSW	8	33574889	missense	possibly damaging	0.93
R6918:Tex15	UTSW	8	33573184	missense	probably benign	0.27
R6958:Tex15	UTSW	8	33570871	missense	probably benign	0.01
R6970:Tex15	UTSW	8	33557428	missense	probably benign	0.03
R7059:Tex15	UTSW	8	33574730	missense	possibly damaging	0.57
R7069:Tex15	UTSW	8	33570720	missense	probably benign
R7072:Tex15	UTSW	8	33575431	missense	possibly damaging	0.85
R7212:Tex15	UTSW	8	33570826	nonsense	probably null
R7212:Tex15	UTSW	8	33572995	missense	probably damaging	1.00
R7216:Tex15	UTSW	8	33572986	missense	possibly damaging	0.93
R7219:Tex15	UTSW	8	33546240	missense	probably benign	0.40
R7313:Tex15	UTSW	8	33574817	missense	possibly damaging	0.82
R7315:Tex15	UTSW	8	33581516	missense	probably benign	0.01
R7444:Tex15	UTSW	8	33576562	missense	possibly damaging	0.92
R7455:Tex15	UTSW	8	33576997	missense	possibly damaging	0.91
R7643:Tex15	UTSW	8	33575120	missense	probably damaging	1.00
R7644:Tex15	UTSW	8	33574417	missense	probably benign	0.01
R7724:Tex15	UTSW	8	33546263	missense	possibly damaging	0.60
R7779:Tex15	UTSW	8	33575281	missense	probably damaging	1.00
R7798:Tex15	UTSW	8	33581847	missense	possibly damaging	0.69
R7816:Tex15	UTSW	8	33581655	missense	probably benign	0.14
R7820:Tex15	UTSW	8	33575062	missense	probably damaging	0.98
R8041:Tex15	UTSW	8	33575846	missense	probably damaging	1.00
R8150:Tex15	UTSW	8	33573506	missense	probably benign	0.06
R8152:Tex15	UTSW	8	33572893	missense	possibly damaging	0.82
R8237:Tex15	UTSW	8	33577399	missense	possibly damaging	0.72
R8250:Tex15	UTSW	8	33565205	missense	probably null	0.27
R8264:Tex15	UTSW	8	33582362	missense	probably benign	0.18
R8279:Tex15	UTSW	8	33571737	missense	probably damaging	0.96
R8353:Tex15	UTSW	8	33576871	nonsense	probably null
R8388:Tex15	UTSW	8	33575209	missense	probably benign	0.00
R8432:Tex15	UTSW	8	33576544	missense	probably damaging	0.99
R8453:Tex15	UTSW	8	33576871	nonsense	probably null
R8489:Tex15	UTSW	8	33577546	missense	probably benign	0.02
R8670:Tex15	UTSW	8	33574718	missense	probably benign	0.19
R8703:Tex15	UTSW	8	33572696	missense	probably benign	0.00
R8871:Tex15	UTSW	8	33576964	missense	possibly damaging	0.62
R8945:Tex15	UTSW	8	33574696	missense	probably benign	0.00
R9104:Tex15	UTSW	8	33570922	missense	possibly damaging	0.86
R9132:Tex15	UTSW	8	33577526	missense	possibly damaging	0.84
R9207:Tex15	UTSW	8	33575756	missense	probably damaging	1.00
R9210:Tex15	UTSW	8	33574291	missense	possibly damaging	0.91
R9330:Tex15	UTSW	8	33575115	missense	probably benign	0.01
R9354:Tex15	UTSW	8	33573316	missense	possibly damaging	0.86
R9440:Tex15	UTSW	8	33582245	missense	possibly damaging	0.90
R9534:Tex15	UTSW	8	33570971	missense	probably benign	0.45
RF005:Tex15	UTSW	8	33576677	missense	probably benign	0.05
X0020:Tex15	UTSW	8	33576579	missense	probably benign	0.03
X0065:Tex15	UTSW	8	33575517	nonsense	probably null
Z1088:Tex15	UTSW	8	33571315	missense	possibly damaging	0.89
Z1088:Tex15	UTSW	8	33571810	missense	possibly damaging	0.68
Z1088:Tex15	UTSW	8	33574870	missense	probably benign
Z1176:Tex15	UTSW	8	33574726	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- GGGAATATGCTTGACCCAAAAG -3'
(R):5'- TTGATGTGGTCTCCATAGGAACTG -3'

Sequencing Primer
(F):5'- GAATATGCTTGACCCAAAAGAAACAC -3'
(R):5'- GTGGTCTCCATAGGAACTGTACAC -3'

Posted On

2022-04-18