Mutagenetix > Incidental Mutation

Incidental Mutation 'R9365:Exoc2'

708920

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R9365 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30856714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 774 (S774T)

Ref Sequence

ENSEMBL: ENSMUSP00000021785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

PDB Structure

RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000021785
AA Change: S774T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: S774T

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102946
AA Change: S774T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: S774T

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Meta Mutation Damage Score

0.0621

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
Ahi1	G	A	10: 20,972,136	R481Q	probably damaging	Het
Arhgef3	T	C	14: 27,379,598	I77T	probably damaging	Het
Ash1l	T	A	3: 88,981,900	V362E	possibly damaging	Het
Bcat2	T	A	7: 45,575,870	F57L	probably damaging	Het
Ccdc73	C	T	2: 104,907,666	L36F	probably damaging	Het
Ccl19	C	T	4: 42,756,288	V15I	probably benign	Het
Cenpe	T	A	3: 135,248,446	V1688E	possibly damaging	Het
Ces1a	A	T	8: 93,048,099	F4I	probably benign	Het
Chchd6	G	A	6: 89,574,431	P83S	probably benign	Het
Cnr1	T	C	4: 33,943,798	M62T	probably benign	Het
Colec12	T	C	18: 9,848,146	L108P	probably damaging	Het
Cyb5a	T	C	18: 84,876,854		probably benign	Het
Dhrs4	C	T	14: 55,487,319	T181I	probably benign	Het
Disc1	T	C	8: 125,124,546	S392P	probably benign	Het
Dnah3	A	G	7: 119,967,636	F69L		Het
Ehmt1	T	C	2: 24,838,710	D726G	probably damaging	Het
Epg5	T	A	18: 77,954,742	L462I	probably damaging	Het
Fam135b	A	G	15: 71,462,964	S794P	probably benign	Het
Frmd4a	T	C	2: 4,602,162	V646A	probably benign	Het
Gm3543	G	T	14: 41,982,136	D57E	possibly damaging	Het
Golgb1	T	A	16: 36,915,762	D1831E	probably damaging	Het
Hace1	T	G	10: 45,709,996		probably null	Het
Irgc1	T	C	7: 24,432,447	E315G	possibly damaging	Het
Ism1	A	G	2: 139,740,401	Y211C	probably damaging	Het
Kpna1	T	G	16: 36,012,917	V121G	probably damaging	Het
Lifr	T	A	15: 7,169,040	F250L	probably damaging	Het
Llgl2	A	G	11: 115,849,581	T368A	probably benign	Het
Lmln	T	A	16: 33,104,799	C467*	probably null	Het
Lrrtm3	T	C	10: 64,088,164	E408G	probably benign	Het
Melk	C	T	4: 44,340,693	A330V	probably null	Het
Mmp13	T	G	9: 7,277,921	D271E	probably benign	Het
Myh11	T	C	16: 14,234,433	T390A		Het
Myh8	A	G	11: 67,283,806	K249R	probably benign	Het
Nr1h4	T	A	10: 89,483,453	M184L	probably damaging	Het
Obscn	T	A	11: 58,994,511		probably null	Het
Otog	T	G	7: 46,271,264	C964G	probably damaging	Het
Oxct2b	T	C	4: 123,116,796	S170P	probably benign	Het
Pcdha4	T	C	18: 36,954,059	S432P	possibly damaging	Het
Prb1	T	A	6: 132,207,238	R477S	unknown	Het
Prh1	G	A	6: 132,572,145	G205D	unknown	Het
Psg23	C	T	7: 18,610,468	G354D	probably damaging	Het
Pura	T	G	18: 36,287,860	D233E	possibly damaging	Het
Rb1cc1	G	T	1: 6,244,893	L423F	probably damaging	Het
Rimbp3	T	C	16: 17,208,756	S15P	possibly damaging	Het
Scn1a	A	G	2: 66,318,121	F7L	probably benign	Het
Sftpb	A	T	6: 72,307,205	R203*	probably null	Het
Slc30a9	A	G	5: 67,349,799	K478R	probably damaging	Het
Slc35f5	T	A	1: 125,568,596	M156K	probably benign	Het
Slc41a3	A	G	6: 90,635,345	I232V	probably benign	Het
Slit2	A	G	5: 48,304,192	D1527G	probably benign	Het
Srfbp1	T	G	18: 52,490,468	V389G	possibly damaging	Het
Sun2	C	T	15: 79,738,519		probably null	Het
Tep1	G	T	14: 50,827,140	A2386D	probably damaging	Het
Tex15	T	A	8: 33,574,536	S1331R	possibly damaging	Het
Tgm1	A	T	14: 55,704,892	N667K	probably damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tsen54	T	C	11: 115,822,584	F438L	probably damaging	Het
Ube4a	T	C	9: 44,950,893	H150R	probably benign	Het
Uty	T	C	Y: 1,099,712	N1161S	possibly damaging	Het
Vmn2r16	T	A	5: 109,340,198	D312E	probably damaging	Het
Wdr55	T	G	18: 36,760,301	C5W	probably damaging	Het
Zbtb24	C	A	10: 41,456,544	P405Q	probably damaging	Het
Zkscan2	T	A	7: 123,480,368	I789F	probably damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GGTCACACCTTTGGTAAGAAGAG -3'
(R):5'- TACTGCCAGTTTGGTCTTTCTACAG -3'

Sequencing Primer
(F):5'- TCACACCTTTGGTAAGAAGAGAAAAG -3'
(R):5'- GGACTTATTTCTTACTGTGTAAGCC -3'

Posted On

2022-04-18