Incidental Mutation 'R9365:Exoc2'
ID 708920
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock # R9365 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30856714 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 774 (S774T)
Ref Sequence ENSEMBL: ENSMUSP00000021785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
PDB Structure RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021785
AA Change: S774T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: S774T

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102946
AA Change: S774T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: S774T

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Ahi1 G A 10: 20,972,136 R481Q probably damaging Het
Arhgef3 T C 14: 27,379,598 I77T probably damaging Het
Ash1l T A 3: 88,981,900 V362E possibly damaging Het
Bcat2 T A 7: 45,575,870 F57L probably damaging Het
Ccdc73 C T 2: 104,907,666 L36F probably damaging Het
Ccl19 C T 4: 42,756,288 V15I probably benign Het
Cenpe T A 3: 135,248,446 V1688E possibly damaging Het
Ces1a A T 8: 93,048,099 F4I probably benign Het
Chchd6 G A 6: 89,574,431 P83S probably benign Het
Cnr1 T C 4: 33,943,798 M62T probably benign Het
Colec12 T C 18: 9,848,146 L108P probably damaging Het
Dhrs4 C T 14: 55,487,319 T181I probably benign Het
Disc1 T C 8: 125,124,546 S392P probably benign Het
Dnah3 A G 7: 119,967,636 F69L Het
Ehmt1 T C 2: 24,838,710 D726G probably damaging Het
Epg5 T A 18: 77,954,742 L462I probably damaging Het
Fam135b A G 15: 71,462,964 S794P probably benign Het
Frmd4a T C 2: 4,602,162 V646A probably benign Het
Gm3543 G T 14: 41,982,136 D57E possibly damaging Het
Golgb1 T A 16: 36,915,762 D1831E probably damaging Het
Hace1 T G 10: 45,709,996 probably null Het
Irgc1 T C 7: 24,432,447 E315G possibly damaging Het
Ism1 A G 2: 139,740,401 Y211C probably damaging Het
Kpna1 T G 16: 36,012,917 V121G probably damaging Het
Lifr T A 15: 7,169,040 F250L probably damaging Het
Llgl2 A G 11: 115,849,581 T368A probably benign Het
Lmln T A 16: 33,104,799 C467* probably null Het
Lrrtm3 T C 10: 64,088,164 E408G probably benign Het
Melk C T 4: 44,340,693 A330V probably null Het
Mmp13 T G 9: 7,277,921 D271E probably benign Het
Myh11 T C 16: 14,234,433 T390A Het
Myh8 A G 11: 67,283,806 K249R probably benign Het
Nr1h4 T A 10: 89,483,453 M184L probably damaging Het
Obscn T A 11: 58,994,511 probably null Het
Otog T G 7: 46,271,264 C964G probably damaging Het
Oxct2b T C 4: 123,116,796 S170P probably benign Het
Pcdha4 T C 18: 36,954,059 S432P possibly damaging Het
Prb1 T A 6: 132,207,238 R477S unknown Het
Prh1 G A 6: 132,572,145 G205D unknown Het
Psg23 C T 7: 18,610,468 G354D probably damaging Het
Pura T G 18: 36,287,860 D233E possibly damaging Het
Rb1cc1 G T 1: 6,244,893 L423F probably damaging Het
Rimbp3 T C 16: 17,208,756 S15P possibly damaging Het
Scn1a A G 2: 66,318,121 F7L probably benign Het
Sftpb A T 6: 72,307,205 R203* probably null Het
Slc30a9 A G 5: 67,349,799 K478R probably damaging Het
Slc35f5 T A 1: 125,568,596 M156K probably benign Het
Slc41a3 A G 6: 90,635,345 I232V probably benign Het
Slit2 A G 5: 48,304,192 D1527G probably benign Het
Srfbp1 T G 18: 52,490,468 V389G possibly damaging Het
Sun2 C T 15: 79,738,519 probably null Het
Tep1 G T 14: 50,827,140 A2386D probably damaging Het
Tex15 T A 8: 33,574,536 S1331R possibly damaging Het
Tgm1 A T 14: 55,704,892 N667K probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tsen54 T C 11: 115,822,584 F438L probably damaging Het
Ube4a T C 9: 44,950,893 H150R probably benign Het
Uty T C Y: 1,099,712 N1161S possibly damaging Het
Vmn2r16 T A 5: 109,340,198 D312E probably damaging Het
Wdr55 T G 18: 36,760,301 C5W probably damaging Het
Zbtb24 C A 10: 41,456,544 P405Q probably damaging Het
Zkscan2 T A 7: 123,480,368 I789F probably damaging Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTCACACCTTTGGTAAGAAGAG -3'
(R):5'- TACTGCCAGTTTGGTCTTTCTACAG -3'

Sequencing Primer
(F):5'- TCACACCTTTGGTAAGAAGAGAAAAG -3'
(R):5'- GGACTTATTTCTTACTGTGTAAGCC -3'
Posted On 2022-04-18