Incidental Mutation 'R9365:Rimbp3'
ID 708930
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms RIM-BP3, LOC239731, LOC385766
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock # R9365 (G1)
Quality Score 189.009
Status Not validated
Chromosome 16
Chromosomal Location 17208603-17213982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17208756 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 15 (S15P)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect possibly damaging
Transcript: ENSMUST00000169803
AA Change: S15P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: S15P

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Ahi1 G A 10: 20,972,136 R481Q probably damaging Het
Arhgef3 T C 14: 27,379,598 I77T probably damaging Het
Ash1l T A 3: 88,981,900 V362E possibly damaging Het
Bcat2 T A 7: 45,575,870 F57L probably damaging Het
Ccdc73 C T 2: 104,907,666 L36F probably damaging Het
Ccl19 C T 4: 42,756,288 V15I probably benign Het
Cenpe T A 3: 135,248,446 V1688E possibly damaging Het
Ces1a A T 8: 93,048,099 F4I probably benign Het
Chchd6 G A 6: 89,574,431 P83S probably benign Het
Cnr1 T C 4: 33,943,798 M62T probably benign Het
Colec12 T C 18: 9,848,146 L108P probably damaging Het
Dhrs4 C T 14: 55,487,319 T181I probably benign Het
Disc1 T C 8: 125,124,546 S392P probably benign Het
Dnah3 A G 7: 119,967,636 F69L Het
Ehmt1 T C 2: 24,838,710 D726G probably damaging Het
Epg5 T A 18: 77,954,742 L462I probably damaging Het
Exoc2 A T 13: 30,856,714 S774T probably benign Het
Fam135b A G 15: 71,462,964 S794P probably benign Het
Frmd4a T C 2: 4,602,162 V646A probably benign Het
Gm3543 G T 14: 41,982,136 D57E possibly damaging Het
Golgb1 T A 16: 36,915,762 D1831E probably damaging Het
Hace1 T G 10: 45,709,996 probably null Het
Irgc1 T C 7: 24,432,447 E315G possibly damaging Het
Ism1 A G 2: 139,740,401 Y211C probably damaging Het
Kpna1 T G 16: 36,012,917 V121G probably damaging Het
Lifr T A 15: 7,169,040 F250L probably damaging Het
Llgl2 A G 11: 115,849,581 T368A probably benign Het
Lmln T A 16: 33,104,799 C467* probably null Het
Lrrtm3 T C 10: 64,088,164 E408G probably benign Het
Melk C T 4: 44,340,693 A330V probably null Het
Mmp13 T G 9: 7,277,921 D271E probably benign Het
Myh11 T C 16: 14,234,433 T390A Het
Myh8 A G 11: 67,283,806 K249R probably benign Het
Nr1h4 T A 10: 89,483,453 M184L probably damaging Het
Obscn T A 11: 58,994,511 probably null Het
Otog T G 7: 46,271,264 C964G probably damaging Het
Oxct2b T C 4: 123,116,796 S170P probably benign Het
Pcdha4 T C 18: 36,954,059 S432P possibly damaging Het
Prb1 T A 6: 132,207,238 R477S unknown Het
Prh1 G A 6: 132,572,145 G205D unknown Het
Psg23 C T 7: 18,610,468 G354D probably damaging Het
Pura T G 18: 36,287,860 D233E possibly damaging Het
Rb1cc1 G T 1: 6,244,893 L423F probably damaging Het
Scn1a A G 2: 66,318,121 F7L probably benign Het
Sftpb A T 6: 72,307,205 R203* probably null Het
Slc30a9 A G 5: 67,349,799 K478R probably damaging Het
Slc35f5 T A 1: 125,568,596 M156K probably benign Het
Slc41a3 A G 6: 90,635,345 I232V probably benign Het
Slit2 A G 5: 48,304,192 D1527G probably benign Het
Srfbp1 T G 18: 52,490,468 V389G possibly damaging Het
Sun2 C T 15: 79,738,519 probably null Het
Tep1 G T 14: 50,827,140 A2386D probably damaging Het
Tex15 T A 8: 33,574,536 S1331R possibly damaging Het
Tgm1 A T 14: 55,704,892 N667K probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tsen54 T C 11: 115,822,584 F438L probably damaging Het
Ube4a T C 9: 44,950,893 H150R probably benign Het
Uty T C Y: 1,099,712 N1161S possibly damaging Het
Vmn2r16 T A 5: 109,340,198 D312E probably damaging Het
Wdr55 T G 18: 36,760,301 C5W probably damaging Het
Zbtb24 C A 10: 41,456,544 P405Q probably damaging Het
Zkscan2 T A 7: 123,480,368 I789F probably damaging Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17211780 missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17210844 missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17211204 missense probably benign
R7440:Rimbp3 UTSW 16 17213201 missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17212704 missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
R8071:Rimbp3 UTSW 16 17210863 missense probably benign
R8272:Rimbp3 UTSW 16 17209105 missense possibly damaging 0.85
R8419:Rimbp3 UTSW 16 17213022 missense probably damaging 0.97
R8819:Rimbp3 UTSW 16 17210907 missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17209006 missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17213020 missense probably benign
R8982:Rimbp3 UTSW 16 17209647 missense probably benign 0.11
Z1176:Rimbp3 UTSW 16 17209474 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGTTATAAGGGAGATCGCC -3'
(R):5'- GCCTGGCGCAATACAACATC -3'

Sequencing Primer
(F):5'- CCCAAGGCGGAAGAGGC -3'
(R):5'- AACATCGCGCTCCTGGTGTAG -3'
Posted On 2022-04-18