Mutagenetix > Incidental Mutation

Incidental Mutation 'R0744:Asxl3'

70896

Institutional Source

Beutler Lab

Gene Symbol

Asxl3

Ensembl Gene

ENSMUSG00000045215

Gene Name

additional sex combs like 3, transcriptional regulator

Synonyms

D930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik

MMRRC Submission

038925-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.347) question?

Stock #

R0744 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22344883-22530227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22516040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 362 (D362G)

Ref Sequence

ENSEMBL: ENSMUSP00000112793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000097655
AA Change: D362G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: D362G

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	173	305	5.6e-50	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2139	2202	9.8e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120223
AA Change: D362G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: D362G

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	179	304	1.3e-36	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2138	2202	1.9e-24	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

98% (91/93)

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,165,069	L41P	probably damaging	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aebp2	T	G	6: 140,642,364		probably null	Het
AI987944	T	C	7: 41,376,859	Y6C	probably damaging	Het
Ascc3	T	C	10: 50,845,666	W2072R	probably benign	Het
Baiap2l1	T	A	5: 144,266,641	D479V	probably benign	Het
Bdp1	A	T	13: 100,035,825	H2094Q	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Cd226	A	C	18: 89,207,020		probably benign	Het
Clip1	T	C	5: 123,630,721	D605G	probably benign	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dzip3	A	G	16: 48,959,675	Y301H	probably damaging	Het
Ephb4	T	A	5: 137,365,667	N600K	probably damaging	Het
Erich6	T	A	3: 58,636,122		probably benign	Het
Fbn1	T	C	2: 125,314,814		probably benign	Het
Fryl	A	T	5: 73,089,081		probably benign	Het
Galnt17	T	A	5: 131,150,916	D131V	probably damaging	Het
Gm13089	A	T	4: 143,698,486	M129K	probably benign	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Gm6619	T	A	6: 131,490,334	L54Q	probably damaging	Het
Herc2	T	C	7: 56,206,036		probably benign	Het
Hic1	T	A	11: 75,165,801	Q754L	possibly damaging	Het
Hnf4g	A	T	3: 3,651,629	D286V	possibly damaging	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itih1	A	T	14: 30,941,555	V164E	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Lrfn5	A	C	12: 61,839,668	T81P	probably damaging	Het
Lrrc58	A	G	16: 37,878,573		probably benign	Het
March6	T	C	15: 31,480,291	Y562C	probably benign	Het
Mark1	T	A	1: 184,921,608	I166F	probably damaging	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mast4	C	G	13: 102,737,387	Q1632H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mgst3	A	G	1: 167,373,805	Y104H	probably damaging	Het
Mlxipl	C	T	5: 135,132,475	T416I	possibly damaging	Het
Mthfd2l	T	C	5: 90,946,942	V90A	probably damaging	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Muc1	C	A	3: 89,230,328	P159Q	possibly damaging	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Myt1	TGAGGAGGAGGAGGAGGAGG	TGAGGAGGAGGAGGAGG	2: 181,797,505		probably benign	Het
Olfr1513	T	C	14: 52,349,378	I223V	probably benign	Het
Olfr329-ps	T	A	11: 58,543,162	M105L	possibly damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Pdcd6	A	G	13: 74,316,324		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Pzp	A	G	6: 128,516,195		probably benign	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapgef3	G	A	15: 97,761,585		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rgs11	T	A	17: 26,203,318	M29K	probably damaging	Het
Rictor	A	G	15: 6,764,278		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Samd9l	T	C	6: 3,372,725	E1512G	possibly damaging	Het
Sgsm1	C	T	5: 113,279,184	A127T	probably benign	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc26a1	T	A	5: 108,673,523	T167S	probably benign	Het
Slc2a12	T	C	10: 22,702,016		probably benign	Het
Slc44a5	T	C	3: 154,265,474	S654P	probably damaging	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Slc6a13	T	G	6: 121,302,867	W67G	probably damaging	Het
Sowahc	GGGAGGAGGAGGAGGAGGAGGAGGAGGA	GGGAGGAGGAGGAGGAGGAGGAGGA	10: 59,223,491		probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Supt20	T	A	3: 54,714,701	Y409N	probably damaging	Het
Synrg	C	T	11: 84,024,305	Q1046*	probably null	Het
Tab2	T	C	10: 7,907,581		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm6	T	C	2: 130,151,761	V640A	probably benign	Het
Tle2	T	C	10: 81,588,947	F667L	probably damaging	Het
Tnfaip3	C	A	10: 19,002,949	A704S	probably benign	Het
Tomm34	T	C	2: 164,070,976	N22D	probably benign	Het
Trabd2b	A	G	4: 114,580,322	Q232R	probably benign	Het
Trim62	A	G	4: 128,884,215	S16G	probably damaging	Het
Ttc28	T	A	5: 111,231,081	I1144N	probably damaging	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Ush2a	C	T	1: 188,814,406		probably benign	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zbed5	T	A	5: 129,902,272	V354E	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Asxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Asxl3	APN	18	22525223	missense	probably benign	0.41
IGL00510:Asxl3	APN	18	22523565	missense	probably damaging	1.00
IGL00864:Asxl3	APN	18	22522446	missense	probably benign	0.06
IGL01074:Asxl3	APN	18	22522845	missense	probably damaging	1.00
IGL01305:Asxl3	APN	18	22516446	missense	probably benign	0.06
IGL01313:Asxl3	APN	18	22517459	missense	probably benign	0.41
IGL01349:Asxl3	APN	18	22524237	missense	probably benign	0.28
IGL01529:Asxl3	APN	18	22517655	missense	probably damaging	1.00
IGL01574:Asxl3	APN	18	22523564	missense	probably benign	0.06
IGL01583:Asxl3	APN	18	22516597	missense	probably benign	0.01
IGL01619:Asxl3	APN	18	22523328	missense	probably damaging	1.00
IGL01720:Asxl3	APN	18	22525325	missense	probably damaging	1.00
IGL01816:Asxl3	APN	18	22522488	missense	probably benign	0.10
IGL01828:Asxl3	APN	18	22525558	utr 3 prime	probably benign
IGL01903:Asxl3	APN	18	22434576	missense	probably benign	0.00
IGL01906:Asxl3	APN	18	22522281	missense	probably benign	0.01
IGL01962:Asxl3	APN	18	22522445	missense	probably benign	0.00
IGL01991:Asxl3	APN	18	22516162	missense	probably damaging	1.00
IGL02064:Asxl3	APN	18	22524344	missense	possibly damaging	0.59
IGL02187:Asxl3	APN	18	22524978	missense	probably damaging	0.99
IGL02219:Asxl3	APN	18	22453626	missense	possibly damaging	0.81
IGL02309:Asxl3	APN	18	22522453	missense	probably benign	0.01
IGL02478:Asxl3	APN	18	22523013	missense	possibly damaging	0.77
IGL02506:Asxl3	APN	18	22452399	missense	probably benign	0.19
IGL02660:Asxl3	APN	18	22524345	missense	probably damaging	0.98
IGL02828:Asxl3	APN	18	22524661	missense	possibly damaging	0.87
IGL02863:Asxl3	APN	18	22523484	missense	probably benign	0.01
IGL03001:Asxl3	APN	18	22517398	missense	probably damaging	1.00
IGL03143:Asxl3	APN	18	22522974	missense	probably benign	0.43
ANU22:Asxl3	UTSW	18	22516446	missense	probably benign	0.06
BB001:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
BB011:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R0145:Asxl3	UTSW	18	22453605	missense	probably damaging	1.00
R0201:Asxl3	UTSW	18	22523154	missense	probably benign
R0207:Asxl3	UTSW	18	22411496	splice site	probably benign
R0230:Asxl3	UTSW	18	22452326	splice site	probably benign
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0344:Asxl3	UTSW	18	22517611	missense	probably benign	0.00
R0519:Asxl3	UTSW	18	22523520	missense	possibly damaging	0.85
R0520:Asxl3	UTSW	18	22522986	missense	probably damaging	0.96
R0548:Asxl3	UTSW	18	22521792	splice site	probably benign
R0626:Asxl3	UTSW	18	22522880	missense	probably benign	0.02
R0711:Asxl3	UTSW	18	22524451	missense	probably benign	0.01
R0833:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R1035:Asxl3	UTSW	18	22525049	missense	probably damaging	1.00
R1170:Asxl3	UTSW	18	22524507	missense	probably benign	0.00
R1372:Asxl3	UTSW	18	22410009	missense	probably benign	0.00
R1440:Asxl3	UTSW	18	22525224	missense	probably benign	0.13
R1463:Asxl3	UTSW	18	22516753	missense	possibly damaging	0.94
R1471:Asxl3	UTSW	18	22516354	missense	probably damaging	1.00
R1618:Asxl3	UTSW	18	22516987	missense	probably damaging	1.00
R1720:Asxl3	UTSW	18	22452435	missense	probably damaging	1.00
R1819:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R1824:Asxl3	UTSW	18	22522068	missense	probably damaging	1.00
R1851:Asxl3	UTSW	18	22517739	missense	probably damaging	0.97
R1989:Asxl3	UTSW	18	22452363	missense	probably damaging	1.00
R2041:Asxl3	UTSW	18	22523451	missense	probably benign	0.02
R2174:Asxl3	UTSW	18	22453644	missense	possibly damaging	0.76
R2175:Asxl3	UTSW	18	22516595	missense	probably benign
R2443:Asxl3	UTSW	18	22411539	missense	probably benign	0.12
R2907:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R4246:Asxl3	UTSW	18	22525500	missense	probably damaging	1.00
R4254:Asxl3	UTSW	18	22524366	missense	possibly damaging	0.58
R4441:Asxl3	UTSW	18	22524233	missense	probably damaging	0.97
R4660:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4661:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4674:Asxl3	UTSW	18	22517738	missense	probably damaging	1.00
R4749:Asxl3	UTSW	18	22516769	missense	probably damaging	0.99
R4817:Asxl3	UTSW	18	22525454	missense	probably damaging	0.97
R4935:Asxl3	UTSW	18	22523312	missense	probably benign	0.06
R5062:Asxl3	UTSW	18	22522718	missense	possibly damaging	0.92
R5064:Asxl3	UTSW	18	22516019	missense	probably benign	0.00
R5065:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5066:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5067:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5133:Asxl3	UTSW	18	22516708	missense	probably damaging	1.00
R5174:Asxl3	UTSW	18	22523115	missense	probably benign	0.45
R5183:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5294:Asxl3	UTSW	18	22516439	missense	possibly damaging	0.77
R5416:Asxl3	UTSW	18	22524494	missense	probably damaging	1.00
R5587:Asxl3	UTSW	18	22525247	missense	probably benign	0.28
R5873:Asxl3	UTSW	18	22516085	missense	probably benign	0.04
R6240:Asxl3	UTSW	18	22465508	missense	probably damaging	1.00
R6242:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R6316:Asxl3	UTSW	18	22522782	missense	probably damaging	1.00
R6348:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R6518:Asxl3	UTSW	18	22516340	missense	probably damaging	0.96
R6605:Asxl3	UTSW	18	22517077	nonsense	probably null
R6704:Asxl3	UTSW	18	22517305	missense	probably benign	0.00
R6706:Asxl3	UTSW	18	22453609	missense	probably damaging	1.00
R6786:Asxl3	UTSW	18	22525440	missense	probably damaging	1.00
R6799:Asxl3	UTSW	18	22465400	nonsense	probably null
R6811:Asxl3	UTSW	18	22522911	missense	possibly damaging	0.87
R6817:Asxl3	UTSW	18	22523580	missense	probably benign	0.00
R6830:Asxl3	UTSW	18	22525388	missense	probably benign	0.45
R6957:Asxl3	UTSW	18	22522091	missense	probably damaging	1.00
R7015:Asxl3	UTSW	18	22523921	missense	probably benign	0.00
R7058:Asxl3	UTSW	18	22517674	missense	probably damaging	1.00
R7135:Asxl3	UTSW	18	22517701	nonsense	probably null
R7135:Asxl3	UTSW	18	22517702	missense	probably damaging	1.00
R7231:Asxl3	UTSW	18	22411499	critical splice acceptor site	probably null
R7231:Asxl3	UTSW	18	22517540	missense	probably damaging	1.00
R7431:Asxl3	UTSW	18	22516953	missense	probably damaging	1.00
R7851:Asxl3	UTSW	18	22517222	missense	possibly damaging	0.62
R7871:Asxl3	UTSW	18	22524224	missense	not run
R7880:Asxl3	UTSW	18	22522151	missense	possibly damaging	0.90
R7924:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R8061:Asxl3	UTSW	18	22524243	missense	possibly damaging	0.62
R8115:Asxl3	UTSW	18	22517585	missense	probably damaging	0.99
R8174:Asxl3	UTSW	18	22517743	missense	probably benign	0.02
R8303:Asxl3	UTSW	18	22524416	missense	probably benign
R8360:Asxl3	UTSW	18	22516117	missense	probably benign
R8547:Asxl3	UTSW	18	22522772	missense	probably benign	0.04
R8699:Asxl3	UTSW	18	22434607	missense	probably benign	0.02
R8774:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8774-TAIL:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8867:Asxl3	UTSW	18	22516490	missense	possibly damaging	0.87
R8915:Asxl3	UTSW	18	22524706	missense	probably benign	0.00
R8954:Asxl3	UTSW	18	22517750	missense	probably damaging	1.00
R9031:Asxl3	UTSW	18	22524344	missense	probably damaging	0.96
R9047:Asxl3	UTSW	18	22452408	missense	probably damaging	1.00
R9047:Asxl3	UTSW	18	22452414	missense	probably damaging	1.00
R9135:Asxl3	UTSW	18	22516613	missense	probably damaging	0.99
R9135:Asxl3	UTSW	18	22524424	missense	possibly damaging	0.89
R9210:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9212:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9285:Asxl3	UTSW	18	22521932	missense	probably damaging	1.00
R9572:Asxl3	UTSW	18	22516055	missense	probably benign	0.25
R9707:Asxl3	UTSW	18	22523247	missense	probably benign	0.01
R9768:Asxl3	UTSW	18	22517044	missense	probably benign	0.00
R9784:Asxl3	UTSW	18	22517254	missense	probably benign
Z1088:Asxl3	UTSW	18	22516772	missense	probably benign	0.00
Z1176:Asxl3	UTSW	18	22522220	missense	probably damaging	1.00
Z1177:Asxl3	UTSW	18	22516339	missense	probably benign	0.00
Z1177:Asxl3	UTSW	18	22523591	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTACTTCTTCCTCAGATCGGGCAT -3'
(R):5'- CAAGCTATCTTCAGGGGCTGCTAC -3'

Sequencing Primer
(F):5'- GCATGTCCAGAGAAGAATCTATTAAG -3'
(R):5'- TGGCAGGACTTTCCGACTC -3'

Posted On

2013-09-30