Incidental Mutation 'R9366:Fa2h'
ID 708980
Institutional Source Beutler Lab
Gene Symbol Fa2h
Ensembl Gene ENSMUSG00000033579
Gene Name fatty acid 2-hydroxylase
Synonyms Faxdc1, G630055L08Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R9366 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 111345135-111393824 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111349374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 206 (Y206N)
Ref Sequence ENSEMBL: ENSMUSP00000043597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038475]
AlphaFold Q5MPP0
Predicted Effect probably benign
Transcript: ENSMUST00000038475
AA Change: Y206N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000043597
Gene: ENSMUSG00000033579
AA Change: Y206N

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Cyt-b5 11 86 2.85e-15 SMART
low complexity region 115 126 N/A INTRINSIC
transmembrane domain 169 191 N/A INTRINSIC
Pfam:FA_hydroxylase 219 361 4.4e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a null allele show demyelination, axonal loss, and cerebellar dysfunction. Homozygotes for a different null allele show late onset axon and myelin sheath degeneration, delayed fur emergence, altered sebum composition, sebocyte hyperproliferation, and cyclic alopecia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 C T 8: 71,461,684 R100Q probably benign Het
Acp5 C T 9: 22,127,928 C163Y probably damaging Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Atp2b4 C A 1: 133,715,182 G1062C probably damaging Het
Bicral A T 17: 46,806,632 M788K possibly damaging Het
C1s2 C A 6: 124,625,735 A506S probably benign Het
Capn9 C G 8: 124,605,541 T417S probably benign Het
Cd109 T G 9: 78,714,993 S1422A probably benign Het
Cd207 G T 6: 83,671,797 N294K probably damaging Het
Cdc42bpa A G 1: 180,094,110 E605G probably damaging Het
Cdhr1 C A 14: 37,089,506 G216V possibly damaging Het
Ckap2 A T 8: 22,168,972 M585K possibly damaging Het
Clp1 G T 2: 84,726,129 S2R probably benign Het
Cngb3 G T 4: 19,395,983 V342F probably benign Het
Col18a1 T C 10: 77,096,424 D65G unknown Het
Col3a1 C T 1: 45,341,231 P972S unknown Het
Cxcr5 C T 9: 44,513,433 C309Y possibly damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dcc A T 18: 71,575,210 N478K probably damaging Het
Emb G T 13: 117,220,560 probably benign Het
Emsy A T 7: 98,641,653 N101K probably benign Het
Epb41l5 A G 1: 119,620,718 Y137H probably damaging Het
Etfdh C T 3: 79,611,964 G354D probably benign Het
Gabrr2 T C 4: 33,085,771 V217A Het
Gimap4 A G 6: 48,691,103 K264R probably benign Het
Gpr31b C A 17: 13,051,488 D265Y probably damaging Het
Irx4 A G 13: 73,268,906 T474A probably benign Het
Kif21a T C 15: 90,959,748 E1096G probably damaging Het
Letm2 A T 8: 25,594,149 V22E probably damaging Het
Lrrc45 A G 11: 120,720,726 E642G probably damaging Het
Mark1 A T 1: 184,921,595 V170E probably damaging Het
Mbd6 G A 10: 127,286,435 Q175* probably null Het
Mrc1 T A 2: 14,316,898 D1067E probably damaging Het
Muc5b A G 7: 141,863,304 H3329R probably benign Het
Myh1 A T 11: 67,219,288 D1434V probably damaging Het
Myo5a T A 9: 75,217,518 L1785Q probably damaging Het
Myrfl A G 10: 116,834,453 I295T possibly damaging Het
Nav3 C A 10: 109,823,503 R751L probably damaging Het
Neb T C 2: 52,282,687 K1536R probably benign Het
Nynrin T G 14: 55,863,130 S126A probably damaging Het
Olfr1031 A G 2: 85,992,387 D190G possibly damaging Het
Olfr1341 A T 4: 118,709,634 T76S probably damaging Het
Olfr822 A T 10: 130,075,198 K263* probably null Het
Parp14 A C 16: 35,839,260 probably null Het
Phldb1 G T 9: 44,711,249 L36M possibly damaging Het
Pin1 C A 9: 20,655,545 T81N probably damaging Het
Pkhd1l1 T C 15: 44,546,912 I2605T probably benign Het
Plcb3 A G 19: 6,960,290 probably null Het
Proser3 G A 7: 30,549,053 S72L probably damaging Het
Pum2 T A 12: 8,733,344 S598T probably benign Het
Pwp1 T A 10: 85,882,006 N269K probably damaging Het
Qsox1 A G 1: 155,789,416 S260P probably benign Het
Ric3 A G 7: 109,054,437 L149P probably damaging Het
Rif1 A G 2: 52,120,344 T707A Het
Rnf213 A C 11: 119,436,231 R1682S Het
Rpgrip1l G T 8: 91,270,181 Y690* probably null Het
Slc29a2 A G 19: 5,024,581 T34A probably damaging Het
Slc6a1 A G 6: 114,304,013 N176S possibly damaging Het
Slco1b2 T A 6: 141,656,826 Y168* probably null Het
Snca C A 6: 60,815,691 A78S probably benign Het
Snrnp200 T A 2: 127,216,090 D257E probably benign Het
Srebf2 T C 15: 82,199,636 V959A probably benign Het
Stk3 A C 15: 35,072,488 I209S probably damaging Het
Tcrg-C3 A G 13: 19,262,655 T115A probably benign Het
Thsd7a A T 6: 12,555,481 C135S Het
Tlnrd1 G T 7: 83,882,374 A283E probably benign Het
Tomm70a A T 16: 57,149,896 K546* probably null Het
Trak1 C T 9: 121,472,512 T778I probably damaging Het
Trappc9 T C 15: 72,937,088 I709V probably benign Het
Trp53rkb T C 2: 166,795,780 S219P possibly damaging Het
Ubqlnl G C 7: 104,149,385 L302V possibly damaging Het
Uqcc1 C A 2: 155,930,075 probably benign Het
Vps13a G A 19: 16,695,530 R1293W probably damaging Het
Vps9d1 G T 8: 123,247,747 S267* probably null Het
Vwa5b1 A T 4: 138,590,918 I546N probably damaging Het
Zbtb8b A T 4: 129,432,358 M338K probably benign Het
Zfp652 C T 11: 95,753,007 R344* probably null Het
Other mutations in Fa2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Fa2h APN 8 111349304 missense possibly damaging 0.55
IGL02983:Fa2h APN 8 111346522 critical splice acceptor site probably null
IGL03350:Fa2h APN 8 111349296 missense probably benign 0.05
sparse UTSW 8 111355398 critical splice donor site probably null
R0016:Fa2h UTSW 8 111393514 missense probably damaging 1.00
R0363:Fa2h UTSW 8 111349289 missense probably damaging 1.00
R0576:Fa2h UTSW 8 111356147 missense probably damaging 1.00
R2914:Fa2h UTSW 8 111393649 missense probably damaging 1.00
R3803:Fa2h UTSW 8 111355398 critical splice donor site probably null
R3924:Fa2h UTSW 8 111393515 missense probably damaging 1.00
R5203:Fa2h UTSW 8 111349364 missense probably benign 0.00
R5253:Fa2h UTSW 8 111349237 missense probably benign 0.00
R6547:Fa2h UTSW 8 111348020 missense probably damaging 1.00
R7595:Fa2h UTSW 8 111355490 missense probably benign 0.01
R8050:Fa2h UTSW 8 111348185 critical splice acceptor site probably null
R8530:Fa2h UTSW 8 111356156 missense probably benign 0.12
R9329:Fa2h UTSW 8 111355483 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATTCTTGGGACAGCTCCTAGG -3'
(R):5'- GCCCTTTCCAAGCCCACTATAG -3'

Sequencing Primer
(F):5'- AGCTGGCTGCACGTGCTAG -3'
(R):5'- TTCCAAGCCCACTATAGATTCC -3'
Posted On 2022-04-18