Mutagenetix > Incidental Mutation

Incidental Mutation 'R9366:Trak1'

708989

Institutional Source

Beutler Lab

Gene Symbol

Trak1

Ensembl Gene

ENSMUSG00000032536

Gene Name

trafficking protein, kinesin binding 1

Synonyms

hyrt, 2310001H13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R9366 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121297502-121474918 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 121472512 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 778 (T778I)

Ref Sequence

ENSEMBL: ENSMUSP00000044482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210798] [ENSMUST00000211301]

AlphaFold

Q6PD31

Predicted Effect

probably damaging
Transcript: ENSMUST00000045903
AA Change: T778I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: T778I

Domain	Start	End	E-Value	Type
Pfam:HAP1_N	47	352	8.1e-139	PFAM
Pfam:Milton	411	580	5e-72	PFAM
low complexity region	882	897	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209446

Predicted Effect

probably benign
Transcript: ENSMUST00000210798

Predicted Effect

probably benign
Transcript: ENSMUST00000211301

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	C	T	8: 71,461,684	R100Q	probably benign	Het
Acp5	C	T	9: 22,127,928	C163Y	probably damaging	Het
Ankrd17	C	T	5: 90,268,649	R1108Q	probably damaging	Het
Atp2b4	C	A	1: 133,715,182	G1062C	probably damaging	Het
Bicral	A	T	17: 46,806,632	M788K	possibly damaging	Het
C1s2	C	A	6: 124,625,735	A506S	probably benign	Het
Capn9	C	G	8: 124,605,541	T417S	probably benign	Het
Cd109	T	G	9: 78,714,993	S1422A	probably benign	Het
Cd207	G	T	6: 83,671,797	N294K	probably damaging	Het
Cdc42bpa	A	G	1: 180,094,110	E605G	probably damaging	Het
Cdhr1	C	A	14: 37,089,506	G216V	possibly damaging	Het
Ckap2	A	T	8: 22,168,972	M585K	possibly damaging	Het
Clp1	G	T	2: 84,726,129	S2R	probably benign	Het
Cngb3	G	T	4: 19,395,983	V342F	probably benign	Het
Col18a1	T	C	10: 77,096,424	D65G	unknown	Het
Col3a1	C	T	1: 45,341,231	P972S	unknown	Het
Cxcr5	C	T	9: 44,513,433	C309Y	possibly damaging	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Dcc	A	T	18: 71,575,210	N478K	probably damaging	Het
Emb	G	T	13: 117,220,560		probably benign	Het
Emsy	A	T	7: 98,641,653	N101K	probably benign	Het
Epb41l5	A	G	1: 119,620,718	Y137H	probably damaging	Het
Etfdh	C	T	3: 79,611,964	G354D	probably benign	Het
Fa2h	A	T	8: 111,349,374	Y206N	probably benign	Het
Gabrr2	T	C	4: 33,085,771	V217A		Het
Gimap4	A	G	6: 48,691,103	K264R	probably benign	Het
Gpr31b	C	A	17: 13,051,488	D265Y	probably damaging	Het
Irx4	A	G	13: 73,268,906	T474A	probably benign	Het
Kif21a	T	C	15: 90,959,748	E1096G	probably damaging	Het
Letm2	A	T	8: 25,594,149	V22E	probably damaging	Het
Lrrc45	A	G	11: 120,720,726	E642G	probably damaging	Het
Mark1	A	T	1: 184,921,595	V170E	probably damaging	Het
Mbd6	G	A	10: 127,286,435	Q175*	probably null	Het
Mrc1	T	A	2: 14,316,898	D1067E	probably damaging	Het
Muc5b	A	G	7: 141,863,304	H3329R	probably benign	Het
Myh1	A	T	11: 67,219,288	D1434V	probably damaging	Het
Myo5a	T	A	9: 75,217,518	L1785Q	probably damaging	Het
Myrfl	A	G	10: 116,834,453	I295T	possibly damaging	Het
Nav3	C	A	10: 109,823,503	R751L	probably damaging	Het
Neb	T	C	2: 52,282,687	K1536R	probably benign	Het
Nynrin	T	G	14: 55,863,130	S126A	probably damaging	Het
Olfr1031	A	G	2: 85,992,387	D190G	possibly damaging	Het
Olfr1341	A	T	4: 118,709,634	T76S	probably damaging	Het
Olfr822	A	T	10: 130,075,198	K263*	probably null	Het
Parp14	A	C	16: 35,839,260		probably null	Het
Phldb1	G	T	9: 44,711,249	L36M	possibly damaging	Het
Pin1	C	A	9: 20,655,545	T81N	probably damaging	Het
Pkhd1l1	T	C	15: 44,546,912	I2605T	probably benign	Het
Plcb3	A	G	19: 6,960,290		probably null	Het
Proser3	G	A	7: 30,549,053	S72L	probably damaging	Het
Pum2	T	A	12: 8,733,344	S598T	probably benign	Het
Pwp1	T	A	10: 85,882,006	N269K	probably damaging	Het
Qsox1	A	G	1: 155,789,416	S260P	probably benign	Het
Ric3	A	G	7: 109,054,437	L149P	probably damaging	Het
Rif1	A	G	2: 52,120,344	T707A		Het
Rnf213	A	C	11: 119,436,231	R1682S		Het
Rpgrip1l	G	T	8: 91,270,181	Y690*	probably null	Het
Slc29a2	A	G	19: 5,024,581	T34A	probably damaging	Het
Slc6a1	A	G	6: 114,304,013	N176S	possibly damaging	Het
Slco1b2	T	A	6: 141,656,826	Y168*	probably null	Het
Snca	C	A	6: 60,815,691	A78S	probably benign	Het
Snrnp200	T	A	2: 127,216,090	D257E	probably benign	Het
Srebf2	T	C	15: 82,199,636	V959A	probably benign	Het
Stk3	A	C	15: 35,072,488	I209S	probably damaging	Het
Tcrg-C3	A	G	13: 19,262,655	T115A	probably benign	Het
Thsd7a	A	T	6: 12,555,481	C135S		Het
Tlnrd1	G	T	7: 83,882,374	A283E	probably benign	Het
Tomm70a	A	T	16: 57,149,896	K546*	probably null	Het
Trappc9	T	C	15: 72,937,088	I709V	probably benign	Het
Trp53rkb	T	C	2: 166,795,780	S219P	possibly damaging	Het
Ubqlnl	G	C	7: 104,149,385	L302V	possibly damaging	Het
Uqcc1	C	A	2: 155,930,075		probably benign	Het
Vps13a	G	A	19: 16,695,530	R1293W	probably damaging	Het
Vps9d1	G	T	8: 123,247,747	S267*	probably null	Het
Vwa5b1	A	T	4: 138,590,918	I546N	probably damaging	Het
Zbtb8b	A	T	4: 129,432,358	M338K	probably benign	Het
Zfp652	C	T	11: 95,753,007	R344*	probably null	Het

Other mutations in Trak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Trak1	APN	9	121443736	critical splice donor site	probably null
IGL01335:Trak1	APN	9	121454316	missense	possibly damaging	0.58
IGL01777:Trak1	APN	9	121431560	splice site	probably null
IGL01804:Trak1	APN	9	121442685	splice site	probably benign
IGL01986:Trak1	APN	9	121472967	missense	probably benign	0.00
IGL02248:Trak1	APN	9	121446794	missense	probably damaging	1.00
IGL02276:Trak1	APN	9	121451668	missense	probably damaging	1.00
IGL02556:Trak1	APN	9	121448901	missense	probably damaging	1.00
IGL03368:Trak1	APN	9	121367122	missense	possibly damaging	0.66
PIT4468001:Trak1	UTSW	9	121453332	missense	probably benign	0.18
R0067:Trak1	UTSW	9	121472907	missense	probably damaging	1.00
R0276:Trak1	UTSW	9	121454338	missense	probably damaging	0.97
R0535:Trak1	UTSW	9	121443712	missense	probably null	1.00
R0629:Trak1	UTSW	9	121367167	missense	probably benign	0.37
R0671:Trak1	UTSW	9	121448955	critical splice donor site	probably null
R0883:Trak1	UTSW	9	121453285	missense	possibly damaging	0.90
R1160:Trak1	UTSW	9	121392007	missense	probably benign	0.01
R1162:Trak1	UTSW	9	121453341	missense	possibly damaging	0.93
R1168:Trak1	UTSW	9	121440679	missense	probably damaging	1.00
R1398:Trak1	UTSW	9	121454359	missense	probably damaging	1.00
R2118:Trak1	UTSW	9	121472997	makesense	probably null
R2119:Trak1	UTSW	9	121472997	makesense	probably null
R2120:Trak1	UTSW	9	121472997	makesense	probably null
R2137:Trak1	UTSW	9	121472962	missense	possibly damaging	0.83
R3162:Trak1	UTSW	9	121451734	splice site	probably benign
R3888:Trak1	UTSW	9	121442797	splice site	probably null
R3889:Trak1	UTSW	9	121445873	missense	probably null	0.40
R4031:Trak1	UTSW	9	121451670	missense	probably damaging	1.00
R4116:Trak1	UTSW	9	121448843	missense	probably damaging	1.00
R4406:Trak1	UTSW	9	121431536	missense	probably damaging	1.00
R4630:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4631:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4632:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4786:Trak1	UTSW	9	121472494	missense	probably benign	0.25
R5137:Trak1	UTSW	9	121367055	intron	probably benign
R5159:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R5467:Trak1	UTSW	9	121446798	missense	probably damaging	1.00
R5661:Trak1	UTSW	9	121443637	missense	possibly damaging	0.46
R5664:Trak1	UTSW	9	121472307	missense	possibly damaging	0.47
R5769:Trak1	UTSW	9	121448838	missense	probably damaging	1.00
R6041:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R6257:Trak1	UTSW	9	121446755	missense	probably damaging	1.00
R6257:Trak1	UTSW	9	121367224	missense	possibly damaging	0.92
R6354:Trak1	UTSW	9	121451726	missense	probably null	0.03
R6399:Trak1	UTSW	9	121453496	splice site	probably null
R6513:Trak1	UTSW	9	121443756	missense	probably benign
R6579:Trak1	UTSW	9	121443638	missense	probably benign	0.29
R6940:Trak1	UTSW	9	121443718	missense	possibly damaging	0.78
R7120:Trak1	UTSW	9	121460498	missense	probably benign
R7299:Trak1	UTSW	9	121451863	splice site	probably null
R7304:Trak1	UTSW	9	121416212	missense	probably benign
R7396:Trak1	UTSW	9	121448907	missense	possibly damaging	0.71
R7522:Trak1	UTSW	9	121442711	missense	probably damaging	0.99
R7657:Trak1	UTSW	9	121472586	missense	probably damaging	1.00
R7733:Trak1	UTSW	9	121367225	missense	possibly damaging	0.92
R7793:Trak1	UTSW	9	121416198	nonsense	probably null
R7999:Trak1	UTSW	9	121460425	missense	probably damaging	1.00
R8209:Trak1	UTSW	9	121451727	missense	probably benign
R8215:Trak1	UTSW	9	121469030	missense	probably damaging	1.00
R8226:Trak1	UTSW	9	121451727	missense	probably benign
R8261:Trak1	UTSW	9	121451667	missense	probably damaging	1.00
R8300:Trak1	UTSW	9	121460499	nonsense	probably null
R8914:Trak1	UTSW	9	121443781	missense	unknown
R9072:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9073:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9312:Trak1	UTSW	9	121451691	missense	probably benign	0.01
R9663:Trak1	UTSW	9	121391858	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- GCAGTACCAGCCACTTGAAATC -3'
(R):5'- GACACATCTGTTTGGCTCTCG -3'

Sequencing Primer
(F):5'- GGCTGAGTCTTTCACAAATGTCCG -3'
(R):5'- TGGCTCTCGCTGCTCCG -3'

Posted On

2022-04-18