Incidental Mutation 'R9366:Stk3'
ID 709006
Institutional Source Beutler Lab
Gene Symbol Stk3
Ensembl Gene ENSMUSG00000022329
Gene Name serine/threonine kinase 3
Synonyms mess1, MST, Mst2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9366 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 34875496-35178921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 35072488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 209 (I209S)
Ref Sequence ENSEMBL: ENSMUSP00000018476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000138841] [ENSMUST00000226555]
AlphaFold Q9JI10
Predicted Effect probably damaging
Transcript: ENSMUST00000018476
AA Change: I209S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329
AA Change: I209S

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 27 278 4.16e-103 SMART
low complexity region 301 324 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Pfam:Mst1_SARAH 443 490 9.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067033
AA Change: I139S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329
AA Change: I139S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 205 2.1e-41 PFAM
Pfam:Pkinase 5 208 1.2e-56 PFAM
coiled coil region 217 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Mst1_SARAH 372 420 9.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138841
Predicted Effect probably damaging
Transcript: ENSMUST00000226555
AA Change: I207S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 C T 8: 71,461,684 R100Q probably benign Het
Acp5 C T 9: 22,127,928 C163Y probably damaging Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Atp2b4 C A 1: 133,715,182 G1062C probably damaging Het
Bicral A T 17: 46,806,632 M788K possibly damaging Het
C1s2 C A 6: 124,625,735 A506S probably benign Het
Capn9 C G 8: 124,605,541 T417S probably benign Het
Cd109 T G 9: 78,714,993 S1422A probably benign Het
Cd207 G T 6: 83,671,797 N294K probably damaging Het
Cdc42bpa A G 1: 180,094,110 E605G probably damaging Het
Cdhr1 C A 14: 37,089,506 G216V possibly damaging Het
Ckap2 A T 8: 22,168,972 M585K possibly damaging Het
Clp1 G T 2: 84,726,129 S2R probably benign Het
Cngb3 G T 4: 19,395,983 V342F probably benign Het
Col18a1 T C 10: 77,096,424 D65G unknown Het
Col3a1 C T 1: 45,341,231 P972S unknown Het
Cxcr5 C T 9: 44,513,433 C309Y possibly damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dcc A T 18: 71,575,210 N478K probably damaging Het
Emb G T 13: 117,220,560 probably benign Het
Emsy A T 7: 98,641,653 N101K probably benign Het
Epb41l5 A G 1: 119,620,718 Y137H probably damaging Het
Etfdh C T 3: 79,611,964 G354D probably benign Het
Fa2h A T 8: 111,349,374 Y206N probably benign Het
Gabrr2 T C 4: 33,085,771 V217A Het
Gimap4 A G 6: 48,691,103 K264R probably benign Het
Gpr31b C A 17: 13,051,488 D265Y probably damaging Het
Irx4 A G 13: 73,268,906 T474A probably benign Het
Kif21a T C 15: 90,959,748 E1096G probably damaging Het
Letm2 A T 8: 25,594,149 V22E probably damaging Het
Lrrc45 A G 11: 120,720,726 E642G probably damaging Het
Mark1 A T 1: 184,921,595 V170E probably damaging Het
Mbd6 G A 10: 127,286,435 Q175* probably null Het
Mrc1 T A 2: 14,316,898 D1067E probably damaging Het
Muc5b A G 7: 141,863,304 H3329R probably benign Het
Myh1 A T 11: 67,219,288 D1434V probably damaging Het
Myo5a T A 9: 75,217,518 L1785Q probably damaging Het
Myrfl A G 10: 116,834,453 I295T possibly damaging Het
Nav3 C A 10: 109,823,503 R751L probably damaging Het
Neb T C 2: 52,282,687 K1536R probably benign Het
Nynrin T G 14: 55,863,130 S126A probably damaging Het
Olfr1031 A G 2: 85,992,387 D190G possibly damaging Het
Olfr1341 A T 4: 118,709,634 T76S probably damaging Het
Olfr822 A T 10: 130,075,198 K263* probably null Het
Parp14 A C 16: 35,839,260 probably null Het
Phldb1 G T 9: 44,711,249 L36M possibly damaging Het
Pin1 C A 9: 20,655,545 T81N probably damaging Het
Pkhd1l1 T C 15: 44,546,912 I2605T probably benign Het
Plcb3 A G 19: 6,960,290 probably null Het
Proser3 G A 7: 30,549,053 S72L probably damaging Het
Pum2 T A 12: 8,733,344 S598T probably benign Het
Pwp1 T A 10: 85,882,006 N269K probably damaging Het
Qsox1 A G 1: 155,789,416 S260P probably benign Het
Ric3 A G 7: 109,054,437 L149P probably damaging Het
Rif1 A G 2: 52,120,344 T707A Het
Rnf213 A C 11: 119,436,231 R1682S Het
Rpgrip1l G T 8: 91,270,181 Y690* probably null Het
Slc29a2 A G 19: 5,024,581 T34A probably damaging Het
Slc6a1 A G 6: 114,304,013 N176S possibly damaging Het
Slco1b2 T A 6: 141,656,826 Y168* probably null Het
Snca C A 6: 60,815,691 A78S probably benign Het
Snrnp200 T A 2: 127,216,090 D257E probably benign Het
Srebf2 T C 15: 82,199,636 V959A probably benign Het
Tcrg-C3 A G 13: 19,262,655 T115A probably benign Het
Thsd7a A T 6: 12,555,481 C135S Het
Tlnrd1 G T 7: 83,882,374 A283E probably benign Het
Tomm70a A T 16: 57,149,896 K546* probably null Het
Trak1 C T 9: 121,472,512 T778I probably damaging Het
Trappc9 T C 15: 72,937,088 I709V probably benign Het
Trp53rkb T C 2: 166,795,780 S219P possibly damaging Het
Ubqlnl G C 7: 104,149,385 L302V possibly damaging Het
Uqcc1 C A 2: 155,930,075 probably benign Het
Vps13a G A 19: 16,695,530 R1293W probably damaging Het
Vps9d1 G T 8: 123,247,747 S267* probably null Het
Vwa5b1 A T 4: 138,590,918 I546N probably damaging Het
Zbtb8b A T 4: 129,432,358 M338K probably benign Het
Zfp652 C T 11: 95,753,007 R344* probably null Het
Other mutations in Stk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Stk3 APN 15 35114622 missense possibly damaging 0.93
IGL02133:Stk3 APN 15 35099516 missense probably damaging 1.00
IGL03121:Stk3 APN 15 35099426 splice site probably benign
IGL03309:Stk3 APN 15 35099551 splice site probably benign
R0276:Stk3 UTSW 15 35099469 missense probably damaging 1.00
R0416:Stk3 UTSW 15 35114632 missense probably benign 0.07
R1352:Stk3 UTSW 15 35008225 missense probably damaging 1.00
R1633:Stk3 UTSW 15 34959060 missense probably damaging 1.00
R1638:Stk3 UTSW 15 35008308 splice site probably null
R1917:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R1919:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R2011:Stk3 UTSW 15 35072498 missense probably damaging 1.00
R2072:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2073:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2075:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R3158:Stk3 UTSW 15 35008241 missense possibly damaging 0.83
R3402:Stk3 UTSW 15 34944998 splice site probably benign
R4633:Stk3 UTSW 15 34958928 missense probably damaging 0.99
R4672:Stk3 UTSW 15 35099457 missense probably benign 0.06
R4687:Stk3 UTSW 15 35114565 missense probably damaging 0.99
R4825:Stk3 UTSW 15 34999908 missense probably benign 0.14
R4903:Stk3 UTSW 15 34959066 missense probably damaging 0.99
R5390:Stk3 UTSW 15 35114560 nonsense probably null
R5834:Stk3 UTSW 15 34959018 missense probably damaging 1.00
R7208:Stk3 UTSW 15 35073116 missense possibly damaging 0.76
R7266:Stk3 UTSW 15 34959036 missense probably benign 0.05
R7862:Stk3 UTSW 15 35115586 missense possibly damaging 0.90
R8354:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R8454:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R8996:Stk3 UTSW 15 34945062 missense possibly damaging 0.51
R9160:Stk3 UTSW 15 35099465 missense probably damaging 0.99
R9777:Stk3 UTSW 15 35114645 missense probably damaging 1.00
X0021:Stk3 UTSW 15 35072555 missense probably damaging 1.00
X0060:Stk3 UTSW 15 35114533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCTGTCAGAGTTCTTTCC -3'
(R):5'- CTAGCAGATCACATGTTTCAATGAC -3'

Sequencing Primer
(F):5'- CATTGTTCAGTGAAAAATGGTCAG -3'
(R):5'- GATCACATGTTTCAATGACTATGTTG -3'
Posted On 2022-04-18