Incidental Mutation 'R9367:Ccdc150'
ID 709019
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Name coiled-coil domain containing 150
Synonyms 4930511H11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9367 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 54250683-54368727 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 54285601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 350 (L350F)
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
AlphaFold Q8CDI7
Predicted Effect probably damaging
Transcript: ENSMUST00000027128
AA Change: L350F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: L350F

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160472
AA Change: L350F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983
AA Change: L350F

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
4930402H24Rik A T 2: 130,739,460 N678K probably benign Het
4930568D16Rik A T 2: 35,354,927 Y138N probably benign Het
Abca4 T C 3: 122,044,548 M1T probably null Het
Acer3 A G 7: 98,259,414 V104A probably damaging Het
Agpat4 A G 17: 12,216,710 E287G probably benign Het
Akip1 C T 7: 109,708,949 A146V unknown Het
Ank2 T C 3: 126,945,029 N2402S unknown Het
Arhgdig A T 17: 26,199,477 Y177* probably null Het
Arhgef38 T A 3: 133,142,237 T355S unknown Het
Atp8a2 C A 14: 60,012,378 probably null Het
Atp8b4 A G 2: 126,374,510 I672T probably damaging Het
Baat T A 4: 49,503,008 D38V probably damaging Het
Bcl9 T C 3: 97,210,545 S278G probably benign Het
Ceacam20 T G 7: 19,971,608 S175A probably damaging Het
Chd6 A T 2: 161,029,864 I217K possibly damaging Het
Cnppd1 T C 1: 75,140,973 I35V probably benign Het
Col15a1 T C 4: 47,245,603 I118T probably damaging Het
Csmd3 A T 15: 47,704,168 Y1289N Het
Dio2 T C 12: 90,729,813 T134A probably benign Het
Dnah17 A G 11: 118,096,638 V1282A possibly damaging Het
Dnah17 A G 11: 118,121,386 S517P possibly damaging Het
Dync2h1 C T 9: 7,125,730 probably null Het
Echdc2 C A 4: 108,178,914 P274Q probably damaging Het
Fam117a T A 11: 95,380,744 C381S probably damaging Het
Fbxl12 A G 9: 20,638,834 F122S probably damaging Het
Gen1 G A 12: 11,241,308 Q892* probably null Het
Gimap4 A G 6: 48,690,812 Y167C probably damaging Het
Gle1 T A 2: 29,949,002 F476L probably damaging Het
Gpr135 A T 12: 72,070,699 V98E possibly damaging Het
Greb1l A T 18: 10,522,130 H742L probably benign Het
Habp2 G T 19: 56,316,349 C392F probably damaging Het
Hapln3 G T 7: 79,121,707 R145S probably damaging Het
Ikbkb A G 8: 22,681,695 C179R probably damaging Het
Kat6a A T 8: 22,910,140 I306L possibly damaging Het
Lmo3 A T 6: 138,365,960 Y140* probably null Het
Lrrc32 T A 7: 98,499,730 N572K probably damaging Het
Lrrn1 T A 6: 107,568,132 M297K probably damaging Het
Magi2 G A 5: 20,561,310 V676I probably damaging Het
Mdga1 T C 17: 29,832,308 *957W probably null Het
Mip G T 10: 128,227,160 G158V probably damaging Het
Mmp14 T C 14: 54,440,503 I527T probably benign Het
Mmp27 G A 9: 7,573,549 G188D probably damaging Het
Mylk4 A T 13: 32,776,253 C17S possibly damaging Het
Naa50 T G 16: 44,157,191 I94R probably damaging Het
Nyap1 A T 5: 137,735,986 Y262N probably damaging Het
Obsl1 A G 1: 75,489,533 V1517A probably benign Het
P4htm T A 9: 108,581,948 M262L probably benign Het
Pappa2 T C 1: 158,956,972 E156G probably benign Het
Pcdhb15 A T 18: 37,474,918 Y401F possibly damaging Het
Pde2a G A 7: 101,511,154 R845H probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Penk C T 4: 4,134,097 M183I probably benign Het
Pole T C 5: 110,297,089 V437A probably damaging Het
Ppp1r7 T C 1: 93,351,540 I114T probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Pwp2 G A 10: 78,178,993 Q386* probably null Het
Rad17 A T 13: 100,633,212 S280T possibly damaging Het
Rhebl1 C T 15: 98,878,533 E128K possibly damaging Het
Sema3e G T 5: 14,241,070 V615L probably benign Het
Slc22a2 A T 17: 12,605,950 Y233F probably benign Het
Ssu2 A G 6: 112,381,014 S123P probably damaging Het
Stk10 A G 11: 32,588,878 E239G Het
Surf6 G T 2: 26,892,368 Q316K probably damaging Het
Tcerg1 G A 18: 42,552,508 D637N possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnxb C A 17: 34,713,019 F2175L probably damaging Het
Trp53i11 G C 2: 93,198,928 V91L probably benign Het
Tspan9 A G 6: 127,967,139 V66A probably damaging Het
Usp16 C T 16: 87,464,781 T95M probably benign Het
Usp9y A T Y: 1,324,982 F1691Y probably damaging Het
Uty A T Y: 1,099,584 L1204I possibly damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vps54 T C 11: 21,300,234 V552A probably benign Het
Vps8 T C 16: 21,521,918 V804A possibly damaging Het
Zfp869 A C 8: 69,708,407 L33R probably damaging Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 splice site probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
R7981:Ccdc150 UTSW 1 54368392 missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54272497 missense probably damaging 0.99
R8201:Ccdc150 UTSW 1 54329487 missense probably benign 0.10
R8688:Ccdc150 UTSW 1 54367973 missense probably damaging 1.00
R8719:Ccdc150 UTSW 1 54263509 missense probably benign 0.00
R8963:Ccdc150 UTSW 1 54272482 missense probably benign 0.14
R9178:Ccdc150 UTSW 1 54272485 missense probably damaging 0.99
R9200:Ccdc150 UTSW 1 54260038 missense probably damaging 1.00
R9332:Ccdc150 UTSW 1 54277751 missense probably damaging 0.99
R9416:Ccdc150 UTSW 1 54278831 missense probably damaging 0.97
R9430:Ccdc150 UTSW 1 54281771 missense probably damaging 1.00
R9576:Ccdc150 UTSW 1 54368385 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACAAGTGGACACTGATAG -3'
(R):5'- CCTTGTGTACCACAGAGTCAAAG -3'

Sequencing Primer
(F):5'- CACTGATAGTGGTCAGAATACAGACC -3'
(R):5'- TGTACCACAGAGTCAAAGGAATTTG -3'
Posted On 2022-04-18