Incidental Mutation 'R9367:Pole'
ID 709042
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Name polymerase (DNA directed), epsilon
Synonyms pol-epsilon
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9367 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110286306-110337474 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110297089 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 437 (V437A)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296]
AlphaFold Q9WVF7
Predicted Effect probably damaging
Transcript: ENSMUST00000007296
AA Change: V437A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: V437A

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
4930402H24Rik A T 2: 130,739,460 N678K probably benign Het
4930568D16Rik A T 2: 35,354,927 Y138N probably benign Het
Abca4 T C 3: 122,044,548 M1T probably null Het
Acer3 A G 7: 98,259,414 V104A probably damaging Het
Agpat4 A G 17: 12,216,710 E287G probably benign Het
Akip1 C T 7: 109,708,949 A146V unknown Het
Ank2 T C 3: 126,945,029 N2402S unknown Het
Arhgdig A T 17: 26,199,477 Y177* probably null Het
Arhgef38 T A 3: 133,142,237 T355S unknown Het
Atp8a2 C A 14: 60,012,378 probably null Het
Atp8b4 A G 2: 126,374,510 I672T probably damaging Het
Baat T A 4: 49,503,008 D38V probably damaging Het
Bcl9 T C 3: 97,210,545 S278G probably benign Het
Ccdc150 C T 1: 54,285,601 L350F probably damaging Het
Ceacam20 T G 7: 19,971,608 S175A probably damaging Het
Chd6 A T 2: 161,029,864 I217K possibly damaging Het
Cnppd1 T C 1: 75,140,973 I35V probably benign Het
Col15a1 T C 4: 47,245,603 I118T probably damaging Het
Csmd3 A T 15: 47,704,168 Y1289N Het
Dio2 T C 12: 90,729,813 T134A probably benign Het
Dnah17 A G 11: 118,096,638 V1282A possibly damaging Het
Dnah17 A G 11: 118,121,386 S517P possibly damaging Het
Dync2h1 C T 9: 7,125,730 probably null Het
Echdc2 C A 4: 108,178,914 P274Q probably damaging Het
Fam117a T A 11: 95,380,744 C381S probably damaging Het
Fbxl12 A G 9: 20,638,834 F122S probably damaging Het
Gen1 G A 12: 11,241,308 Q892* probably null Het
Gimap4 A G 6: 48,690,812 Y167C probably damaging Het
Gle1 T A 2: 29,949,002 F476L probably damaging Het
Gpr135 A T 12: 72,070,699 V98E possibly damaging Het
Greb1l A T 18: 10,522,130 H742L probably benign Het
Habp2 G T 19: 56,316,349 C392F probably damaging Het
Hapln3 G T 7: 79,121,707 R145S probably damaging Het
Ikbkb A G 8: 22,681,695 C179R probably damaging Het
Kat6a A T 8: 22,910,140 I306L possibly damaging Het
Lmo3 A T 6: 138,365,960 Y140* probably null Het
Lrrc32 T A 7: 98,499,730 N572K probably damaging Het
Lrrn1 T A 6: 107,568,132 M297K probably damaging Het
Magi2 G A 5: 20,561,310 V676I probably damaging Het
Mdga1 T C 17: 29,832,308 *957W probably null Het
Mip G T 10: 128,227,160 G158V probably damaging Het
Mmp14 T C 14: 54,440,503 I527T probably benign Het
Mmp27 G A 9: 7,573,549 G188D probably damaging Het
Mylk4 A T 13: 32,776,253 C17S possibly damaging Het
Naa50 T G 16: 44,157,191 I94R probably damaging Het
Nyap1 A T 5: 137,735,986 Y262N probably damaging Het
Obsl1 A G 1: 75,489,533 V1517A probably benign Het
P4htm T A 9: 108,581,948 M262L probably benign Het
Pappa2 T C 1: 158,956,972 E156G probably benign Het
Pcdhb15 A T 18: 37,474,918 Y401F possibly damaging Het
Pde2a G A 7: 101,511,154 R845H probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Penk C T 4: 4,134,097 M183I probably benign Het
Ppp1r7 T C 1: 93,351,540 I114T probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Pwp2 G A 10: 78,178,993 Q386* probably null Het
Rad17 A T 13: 100,633,212 S280T possibly damaging Het
Rhebl1 C T 15: 98,878,533 E128K possibly damaging Het
Sema3e G T 5: 14,241,070 V615L probably benign Het
Slc22a2 A T 17: 12,605,950 Y233F probably benign Het
Ssu2 A G 6: 112,381,014 S123P probably damaging Het
Stk10 A G 11: 32,588,878 E239G Het
Surf6 G T 2: 26,892,368 Q316K probably damaging Het
Tcerg1 G A 18: 42,552,508 D637N possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnxb C A 17: 34,713,019 F2175L probably damaging Het
Trp53i11 G C 2: 93,198,928 V91L probably benign Het
Tspan9 A G 6: 127,967,139 V66A probably damaging Het
Usp16 C T 16: 87,464,781 T95M probably benign Het
Usp9y A T Y: 1,324,982 F1691Y probably damaging Het
Uty A T Y: 1,099,584 L1204I possibly damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vps54 T C 11: 21,300,234 V552A probably benign Het
Vps8 T C 16: 21,521,918 V804A possibly damaging Het
Zfp869 A C 8: 69,708,407 L33R probably damaging Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7067:Pole UTSW 5 110334218 missense probably damaging 1.00
R7097:Pole UTSW 5 110325102 splice site probably null
R7122:Pole UTSW 5 110325102 splice site probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
R7509:Pole UTSW 5 110330705 start gained probably benign
R7557:Pole UTSW 5 110312994 missense probably damaging 1.00
R7740:Pole UTSW 5 110331041 missense probably benign 0.00
R7792:Pole UTSW 5 110297466 splice site probably null
R7832:Pole UTSW 5 110317797 missense probably benign 0.00
R7849:Pole UTSW 5 110332548 missense probably benign 0.04
R7852:Pole UTSW 5 110306829 missense probably damaging 1.00
R7960:Pole UTSW 5 110289861 missense possibly damaging 0.81
R8001:Pole UTSW 5 110312734 missense probably damaging 1.00
R8266:Pole UTSW 5 110294920 missense probably damaging 1.00
R8510:Pole UTSW 5 110334446 missense probably damaging 0.99
R8793:Pole UTSW 5 110297748 missense probably damaging 1.00
R8835:Pole UTSW 5 110306909 missense probably damaging 1.00
R8863:Pole UTSW 5 110289367 missense possibly damaging 0.94
R8929:Pole UTSW 5 110297788 missense probably damaging 0.98
R8968:Pole UTSW 5 110312083 missense possibly damaging 0.78
R8992:Pole UTSW 5 110323622 missense possibly damaging 0.88
R9018:Pole UTSW 5 110289809 missense probably benign 0.37
R9177:Pole UTSW 5 110332422 missense probably benign 0.04
R9250:Pole UTSW 5 110299821 missense possibly damaging 0.88
R9262:Pole UTSW 5 110325556 missense probably damaging 0.99
R9262:Pole UTSW 5 110325557 missense probably damaging 1.00
R9383:Pole UTSW 5 110291026 missense possibly damaging 0.61
R9626:Pole UTSW 5 110312093 missense possibly damaging 0.68
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Z1177:Pole UTSW 5 110297009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGCTCAAGTGGCATTG -3'
(R):5'- CCAAGGGTCCAAGGAAATTCATG -3'

Sequencing Primer
(F):5'- AGGCTCAAGTGGCATTGGTTTC -3'
(R):5'- GGTCCAAGGAAATTCATGAAATAAAG -3'
Posted On 2022-04-18