Incidental Mutation 'R9367:Hapln3'
ID 709053
Institutional Source Beutler Lab
Gene Symbol Hapln3
Ensembl Gene ENSMUSG00000030606
Gene Name hyaluronan and proteoglycan link protein 3
Synonyms Lpr3, 4930554N11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9367 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 79115102-79131018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 79121707 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 145 (R145S)
Ref Sequence ENSEMBL: ENSMUSP00000146090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032827] [ENSMUST00000205782] [ENSMUST00000206092]
AlphaFold Q80WM5
Predicted Effect probably benign
Transcript: ENSMUST00000032827
SMART Domains Protein: ENSMUSP00000032827
Gene: ENSMUSG00000030606

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 65 148 3.28e-8 SMART
LINK 164 261 1.78e-46 SMART
LINK 265 357 3.14e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205782
AA Change: R145S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000206092
AA Change: R145S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the hyaluronan and proteoglycan binding link protein gene family. The protein encoded by this gene may function in hyaluronic acid binding and cell adhesion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
4930402H24Rik A T 2: 130,739,460 N678K probably benign Het
4930568D16Rik A T 2: 35,354,927 Y138N probably benign Het
Abca4 T C 3: 122,044,548 M1T probably null Het
Acer3 A G 7: 98,259,414 V104A probably damaging Het
Agpat4 A G 17: 12,216,710 E287G probably benign Het
Akip1 C T 7: 109,708,949 A146V unknown Het
Ank2 T C 3: 126,945,029 N2402S unknown Het
Arhgdig A T 17: 26,199,477 Y177* probably null Het
Arhgef38 T A 3: 133,142,237 T355S unknown Het
Atp8a2 C A 14: 60,012,378 probably null Het
Atp8b4 A G 2: 126,374,510 I672T probably damaging Het
Baat T A 4: 49,503,008 D38V probably damaging Het
Bcl9 T C 3: 97,210,545 S278G probably benign Het
Ccdc150 C T 1: 54,285,601 L350F probably damaging Het
Ceacam20 T G 7: 19,971,608 S175A probably damaging Het
Chd6 A T 2: 161,029,864 I217K possibly damaging Het
Cnppd1 T C 1: 75,140,973 I35V probably benign Het
Col15a1 T C 4: 47,245,603 I118T probably damaging Het
Csmd3 A T 15: 47,704,168 Y1289N Het
Dio2 T C 12: 90,729,813 T134A probably benign Het
Dnah17 A G 11: 118,096,638 V1282A possibly damaging Het
Dnah17 A G 11: 118,121,386 S517P possibly damaging Het
Dync2h1 C T 9: 7,125,730 probably null Het
Echdc2 C A 4: 108,178,914 P274Q probably damaging Het
Fam117a T A 11: 95,380,744 C381S probably damaging Het
Fbxl12 A G 9: 20,638,834 F122S probably damaging Het
Gen1 G A 12: 11,241,308 Q892* probably null Het
Gimap4 A G 6: 48,690,812 Y167C probably damaging Het
Gle1 T A 2: 29,949,002 F476L probably damaging Het
Gpr135 A T 12: 72,070,699 V98E possibly damaging Het
Greb1l A T 18: 10,522,130 H742L probably benign Het
Habp2 G T 19: 56,316,349 C392F probably damaging Het
Ikbkb A G 8: 22,681,695 C179R probably damaging Het
Kat6a A T 8: 22,910,140 I306L possibly damaging Het
Lmo3 A T 6: 138,365,960 Y140* probably null Het
Lrrc32 T A 7: 98,499,730 N572K probably damaging Het
Lrrn1 T A 6: 107,568,132 M297K probably damaging Het
Magi2 G A 5: 20,561,310 V676I probably damaging Het
Mdga1 T C 17: 29,832,308 *957W probably null Het
Mip G T 10: 128,227,160 G158V probably damaging Het
Mmp14 T C 14: 54,440,503 I527T probably benign Het
Mmp27 G A 9: 7,573,549 G188D probably damaging Het
Mylk4 A T 13: 32,776,253 C17S possibly damaging Het
Naa50 T G 16: 44,157,191 I94R probably damaging Het
Nyap1 A T 5: 137,735,986 Y262N probably damaging Het
Obsl1 A G 1: 75,489,533 V1517A probably benign Het
P4htm T A 9: 108,581,948 M262L probably benign Het
Pappa2 T C 1: 158,956,972 E156G probably benign Het
Pcdhb15 A T 18: 37,474,918 Y401F possibly damaging Het
Pde2a G A 7: 101,511,154 R845H probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Penk C T 4: 4,134,097 M183I probably benign Het
Pole T C 5: 110,297,089 V437A probably damaging Het
Ppp1r7 T C 1: 93,351,540 I114T probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Pwp2 G A 10: 78,178,993 Q386* probably null Het
Rad17 A T 13: 100,633,212 S280T possibly damaging Het
Rhebl1 C T 15: 98,878,533 E128K possibly damaging Het
Sema3e G T 5: 14,241,070 V615L probably benign Het
Slc22a2 A T 17: 12,605,950 Y233F probably benign Het
Ssu2 A G 6: 112,381,014 S123P probably damaging Het
Stk10 A G 11: 32,588,878 E239G Het
Surf6 G T 2: 26,892,368 Q316K probably damaging Het
Tcerg1 G A 18: 42,552,508 D637N possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnxb C A 17: 34,713,019 F2175L probably damaging Het
Trp53i11 G C 2: 93,198,928 V91L probably benign Het
Tspan9 A G 6: 127,967,139 V66A probably damaging Het
Usp16 C T 16: 87,464,781 T95M probably benign Het
Usp9y A T Y: 1,324,982 F1691Y probably damaging Het
Uty A T Y: 1,099,584 L1204I possibly damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vps54 T C 11: 21,300,234 V552A probably benign Het
Vps8 T C 16: 21,521,918 V804A possibly damaging Het
Zfp869 A C 8: 69,708,407 L33R probably damaging Het
Other mutations in Hapln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hapln3 APN 7 79121983 missense probably damaging 1.00
IGL01412:Hapln3 APN 7 79117436 splice site probably null
IGL02141:Hapln3 APN 7 79118145 missense probably damaging 0.99
IGL02675:Hapln3 APN 7 79117848 critical splice donor site probably null
IGL02864:Hapln3 APN 7 79118064 missense probably benign 0.03
IGL02894:Hapln3 APN 7 79121773 missense probably benign 0.03
R1271:Hapln3 UTSW 7 79118016 missense probably damaging 1.00
R1337:Hapln3 UTSW 7 79118076 missense probably benign 0.06
R1351:Hapln3 UTSW 7 79121960 missense probably damaging 1.00
R1686:Hapln3 UTSW 7 79121890 missense probably benign 0.13
R1718:Hapln3 UTSW 7 79123450 missense unknown
R3103:Hapln3 UTSW 7 79121736 missense probably benign 0.07
R5625:Hapln3 UTSW 7 79117258 splice site probably null
R5669:Hapln3 UTSW 7 79117496 splice site probably null
R5862:Hapln3 UTSW 7 79121891 missense possibly damaging 0.84
R5875:Hapln3 UTSW 7 79121973 missense probably benign 0.03
R7129:Hapln3 UTSW 7 79121824 missense probably damaging 1.00
R7439:Hapln3 UTSW 7 79117269 missense probably benign 0.00
R7713:Hapln3 UTSW 7 79117373 missense probably benign 0.00
R8894:Hapln3 UTSW 7 79117491 missense probably benign 0.00
R8896:Hapln3 UTSW 7 79117491 missense probably benign 0.00
R8933:Hapln3 UTSW 7 79117630 unclassified probably benign
R9114:Hapln3 UTSW 7 79121964 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAACCAGCTCCCATTTCC -3'
(R):5'- CAAGACATGTGCGTGTTAAGTG -3'

Sequencing Primer
(F):5'- GGAAGTTGCTCCCTGAGTTCAAAC -3'
(R):5'- TGGTGGAAGTTGTCAGAGAATG -3'
Posted On 2022-04-18