Incidental Mutation 'R0745:Abhd12'
ID70906
Institutional Source Beutler Lab
Gene Symbol Abhd12
Ensembl Gene ENSMUSG00000032046
Gene Nameabhydrolase domain containing 12
Synonyms
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150832493-150904741 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 150833148 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045441] [ENSMUST00000056149] [ENSMUST00000056149] [ENSMUST00000056149] [ENSMUST00000141899] [ENSMUST00000141899] [ENSMUST00000141899]
Predicted Effect probably benign
Transcript: ENSMUST00000045441
SMART Domains Protein: ENSMUSP00000035743
Gene: ENSMUSG00000033059

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000056149
SMART Domains Protein: ENSMUSP00000053558
Gene: ENSMUSG00000032046

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Hydrolase_4 165 297 1.2e-16 PFAM
Pfam:Abhydrolase_1 169 302 1.6e-13 PFAM
Pfam:Abhydrolase_5 170 359 2.5e-22 PFAM
Pfam:Abhydrolase_6 171 363 1.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000056149
SMART Domains Protein: ENSMUSP00000053558
Gene: ENSMUSG00000032046

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Hydrolase_4 165 297 1.2e-16 PFAM
Pfam:Abhydrolase_1 169 302 1.6e-13 PFAM
Pfam:Abhydrolase_5 170 359 2.5e-22 PFAM
Pfam:Abhydrolase_6 171 363 1.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000056149
SMART Domains Protein: ENSMUSP00000053558
Gene: ENSMUSG00000032046

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Hydrolase_4 165 297 1.2e-16 PFAM
Pfam:Abhydrolase_1 169 302 1.6e-13 PFAM
Pfam:Abhydrolase_5 170 359 2.5e-22 PFAM
Pfam:Abhydrolase_6 171 363 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138608
Predicted Effect probably benign
Transcript: ENSMUST00000141899
SMART Domains Protein: ENSMUSP00000122763
Gene: ENSMUSG00000032046

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Abhydrolase_5 170 295 1.9e-16 PFAM
Pfam:Abhydrolase_6 171 293 3.8e-15 PFAM
Pfam:Abhydrolase_3 171 295 1.1e-6 PFAM
Pfam:Abhydrolase_1 198 271 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141899
SMART Domains Protein: ENSMUSP00000122763
Gene: ENSMUSG00000032046

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Abhydrolase_5 170 295 1.9e-16 PFAM
Pfam:Abhydrolase_6 171 293 3.8e-15 PFAM
Pfam:Abhydrolase_3 171 295 1.1e-6 PFAM
Pfam:Abhydrolase_1 198 271 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141899
SMART Domains Protein: ENSMUSP00000122763
Gene: ENSMUSG00000032046

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Abhydrolase_5 170 295 1.9e-16 PFAM
Pfam:Abhydrolase_6 171 293 3.8e-15 PFAM
Pfam:Abhydrolase_3 171 295 1.1e-6 PFAM
Pfam:Abhydrolase_1 198 271 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156641
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurological symptoms of neurodegeneration, hearing loss, ataxia, microgliosis and reduced brain lysophosphatidylserine lipase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Abhd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Abhd12 APN 2 150848421 missense probably benign 0.00
IGL02399:Abhd12 APN 2 150858493 splice site probably benign
IGL02437:Abhd12 APN 2 150834369 missense probably benign 0.01
IGL02981:Abhd12 APN 2 150833124 missense probably benign
R0423:Abhd12 UTSW 2 150838392 missense possibly damaging 0.89
R0617:Abhd12 UTSW 2 150846365 critical splice acceptor site probably null
R1651:Abhd12 UTSW 2 150848421 missense probably benign 0.00
R1829:Abhd12 UTSW 2 150843398 missense probably damaging 1.00
R1832:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R1833:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R2298:Abhd12 UTSW 2 150901494 intron probably benign
R3153:Abhd12 UTSW 2 150834355 missense probably benign 0.21
R4077:Abhd12 UTSW 2 150848459 critical splice acceptor site probably null
R4508:Abhd12 UTSW 2 150904355 critical splice donor site probably benign
R5193:Abhd12 UTSW 2 150835306 makesense probably null
R5898:Abhd12 UTSW 2 150839778 missense possibly damaging 0.89
R6250:Abhd12 UTSW 2 150839747 missense probably damaging 1.00
R8334:Abhd12 UTSW 2 150858453 missense probably benign
R8354:Abhd12 UTSW 2 150834377 missense probably damaging 0.97
Z1177:Abhd12 UTSW 2 150904414 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTTCCTCACAGGTCCATCAGGAGC -3'
(R):5'- TGAGCACTGTTGCTGCTGAAAGG -3'

Sequencing Primer
(F):5'- TCCATCAGGAGCCTCTGC -3'
(R):5'- GAGCAATATCCTGTGTAGTCCAGAC -3'
Posted On2013-09-30