Incidental Mutation 'R0745:Hsd3b5'
ID70908
Institutional Source Beutler Lab
Gene Symbol Hsd3b5
Ensembl Gene ENSMUSG00000038092
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms3(beta)HSDV
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98618634-98630252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98619539 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 197 (V197A)
Ref Sequence ENSEMBL: ENSMUSP00000041442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044094]
Predicted Effect probably benign
Transcript: ENSMUST00000044094
AA Change: V197A

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041442
Gene: ENSMUSG00000038092
AA Change: V197A

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 261 1.8e-8 PFAM
Pfam:KR 5 133 3.2e-8 PFAM
Pfam:Polysacc_synt_2 6 134 5.9e-12 PFAM
Pfam:NmrA 6 147 2.7e-12 PFAM
Pfam:Epimerase 6 249 1.2e-23 PFAM
Pfam:GDP_Man_Dehyd 7 187 5.6e-12 PFAM
Pfam:3Beta_HSD 7 288 2e-105 PFAM
Pfam:NAD_binding_4 8 220 3.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Hsd3b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Hsd3b5 APN 3 98630057 missense probably benign 0.05
IGL00827:Hsd3b5 APN 3 98630098 missense probably benign 0.00
IGL01530:Hsd3b5 APN 3 98619123 missense probably damaging 1.00
IGL01930:Hsd3b5 APN 3 98622159 missense probably benign 0.01
IGL02363:Hsd3b5 APN 3 98630105 missense probably benign 0.08
IGL02396:Hsd3b5 APN 3 98622027 missense probably benign 0.05
IGL02448:Hsd3b5 APN 3 98622131 missense probably damaging 1.00
R0045:Hsd3b5 UTSW 3 98619144 missense probably benign
R0624:Hsd3b5 UTSW 3 98619404 missense probably damaging 0.98
R0848:Hsd3b5 UTSW 3 98619355 missense probably damaging 1.00
R1112:Hsd3b5 UTSW 3 98630077 missense probably benign 0.00
R1454:Hsd3b5 UTSW 3 98619530 missense probably benign 0.01
R1631:Hsd3b5 UTSW 3 98622077 missense probably damaging 1.00
R1657:Hsd3b5 UTSW 3 98619720 missense possibly damaging 0.89
R1839:Hsd3b5 UTSW 3 98619728 missense probably benign 0.30
R2930:Hsd3b5 UTSW 3 98619212 missense probably benign 0.03
R2982:Hsd3b5 UTSW 3 98619800 missense possibly damaging 0.88
R3158:Hsd3b5 UTSW 3 98622059 missense probably benign 0.00
R4573:Hsd3b5 UTSW 3 98619648 missense probably benign 0.04
R4941:Hsd3b5 UTSW 3 98619063 missense probably damaging 1.00
R5104:Hsd3b5 UTSW 3 98619276 missense probably damaging 1.00
R5416:Hsd3b5 UTSW 3 98619150 missense probably damaging 1.00
R6311:Hsd3b5 UTSW 3 98630090 missense possibly damaging 0.79
R6861:Hsd3b5 UTSW 3 98622012 missense probably damaging 1.00
R7307:Hsd3b5 UTSW 3 98619769 missense probably damaging 0.97
R7339:Hsd3b5 UTSW 3 98622074 missense probably damaging 1.00
R7615:Hsd3b5 UTSW 3 98630104 missense probably damaging 0.99
R7673:Hsd3b5 UTSW 3 98619441 missense probably damaging 1.00
R7883:Hsd3b5 UTSW 3 98622140 missense probably benign 0.00
R8398:Hsd3b5 UTSW 3 98619404 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTAAACTGGACGTAGCAGGAAGCTC -3'
(R):5'- GCATCGTGAAAGCACATGGCCTAAC -3'

Sequencing Primer
(F):5'- AGCTCACAGTTTCCAGCAGG -3'
(R):5'- GCACATGGCCTAACCCATAC -3'
Posted On2013-09-30