Incidental Mutation 'R0745:Trmo'
ID70909
Institutional Source Beutler Lab
Gene Symbol Trmo
Ensembl Gene ENSMUSG00000028331
Gene NametRNA methyltransferase O
Synonyms5830415F09Rik
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46376505-46389437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46382104 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 338 (F338L)
Ref Sequence ENSEMBL: ENSMUSP00000119785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030015] [ENSMUST00000086563] [ENSMUST00000151903]
Predicted Effect probably damaging
Transcript: ENSMUST00000030015
AA Change: F331L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030015
Gene: ENSMUSG00000028331
AA Change: F331L

DomainStartEndE-ValueType
Pfam:UPF0066 42 165 2.3e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086563
AA Change: F331L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083752
Gene: ENSMUSG00000028331
AA Change: F331L

DomainStartEndE-ValueType
Pfam:UPF0066 44 164 1.2e-46 PFAM
low complexity region 431 442 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151903
AA Change: F338L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119785
Gene: ENSMUSG00000028331
AA Change: F338L

DomainStartEndE-ValueType
Pfam:UPF0066 49 172 4.1e-45 PFAM
Meta Mutation Damage Score 0.6675 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Trmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Trmo APN 4 46382490 missense probably benign
IGL01296:Trmo APN 4 46387589 missense probably damaging 1.00
IGL01308:Trmo APN 4 46377053 utr 3 prime probably benign
IGL01544:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01545:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01722:Trmo APN 4 46386092 critical splice donor site probably null
IGL02085:Trmo APN 4 46380217 missense probably damaging 1.00
IGL02927:Trmo APN 4 46387602 missense probably damaging 1.00
R0645:Trmo UTSW 4 46377083 utr 3 prime probably benign
R1365:Trmo UTSW 4 46380278 missense probably damaging 1.00
R1835:Trmo UTSW 4 46380158 missense probably damaging 1.00
R3928:Trmo UTSW 4 46382647 missense probably damaging 1.00
R3929:Trmo UTSW 4 46382647 missense probably damaging 1.00
R4497:Trmo UTSW 4 46382140 missense probably damaging 1.00
R4938:Trmo UTSW 4 46382388 missense probably benign 0.00
R4980:Trmo UTSW 4 46389364 nonsense probably null
R5209:Trmo UTSW 4 46387740 missense probably damaging 0.99
R5639:Trmo UTSW 4 46382073 missense probably benign 0.00
R5855:Trmo UTSW 4 46382568 missense probably benign 0.43
R6151:Trmo UTSW 4 46389390 missense probably damaging 1.00
R7351:Trmo UTSW 4 46387716 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACGCTTTCACCAGTGTCAACCG -3'
(R):5'- TGTCAGAAATCCAGCACACTTTGCC -3'

Sequencing Primer
(F):5'- TGTCAACCGTGACGAGATTC -3'
(R):5'- GATATGCCCGAAAATCAGCTTG -3'
Posted On2013-09-30